ID: 1127793935

View in Genome Browser
Species Human (GRCh38)
Location 15:62422645-62422667
Sequence GCTGCTGGAGTGCCAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 3, 3: 62, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127793935_1127793938 0 Left 1127793935 15:62422645-62422667 CCATCTCCTGGCACTCCAGCAGC 0: 1
1: 1
2: 3
3: 62
4: 500
Right 1127793938 15:62422668-62422690 AATGCAGAAATGCCTTCCACAGG 0: 1
1: 0
2: 0
3: 19
4: 423
1127793935_1127793939 4 Left 1127793935 15:62422645-62422667 CCATCTCCTGGCACTCCAGCAGC 0: 1
1: 1
2: 3
3: 62
4: 500
Right 1127793939 15:62422672-62422694 CAGAAATGCCTTCCACAGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127793935 Original CRISPR GCTGCTGGAGTGCCAGGAGA TGG (reversed) Intronic
900394213 1:2446484-2446506 GCTGCAGGGGTCCCAGGAGGCGG + Intronic
900408520 1:2502743-2502765 GCTGCTGGAGTCCGAGGACATGG - Intronic
900875080 1:5336677-5336699 GCTGATGGATTTCCATGAGATGG - Intergenic
900956823 1:5891472-5891494 CCTGCTTTAGGGCCAGGAGAGGG - Intronic
901475297 1:9485296-9485318 GCTACTGGAGGGCCAGGCGTGGG + Intergenic
901475602 1:9487172-9487194 GATGCTGGAGTGACCGGAGGAGG - Intergenic
901516814 1:9753235-9753257 GCTGCTGATGTGACAGGAGGTGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901664503 1:10818778-10818800 GCAGCTGGAGTGCCAGGTCTGGG - Intergenic
901790351 1:11650571-11650593 GCTGCTCAAGTGCCAGCAGGAGG - Exonic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902369861 1:15999243-15999265 GCAGCTGGGGAGCCAGCAGAGGG + Intergenic
902764728 1:18606757-18606779 GCAGCTGGAGTTCCGGGAGTTGG - Intergenic
902800433 1:18826257-18826279 GGAGCTGGAATGGCAGGAGATGG + Intergenic
903173551 1:21568003-21568025 ACTCCTGGAGTCCCTGGAGATGG - Intronic
904093983 1:27963521-27963543 GCTGCTGGTGTGGCAGCAGGAGG + Exonic
905106322 1:35565591-35565613 GCTGCAGGCGGGCGAGGAGACGG + Exonic
905330024 1:37188051-37188073 GCTGCTAGAGTGTCAGTACACGG + Intergenic
905947609 1:41917164-41917186 TCTGGGGGAGAGCCAGGAGATGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906001998 1:42434577-42434599 GCTGCTGAACTGACAGGAGGTGG - Intronic
906440266 1:45837045-45837067 GCTGCTGATCTGACAGGAGACGG + Intronic
906528538 1:46510440-46510462 GCCGTTGGAGGGCAAGGAGAGGG - Intronic
906740793 1:48181884-48181906 GCTGCTGATCTGACAGGAGACGG + Intergenic
907276484 1:53319665-53319687 GCAGCCGGAGTGGCAGGGGAGGG - Intronic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
908916935 1:69139045-69139067 GCTACTGAAATGCCAAGAGATGG - Intergenic
909516018 1:76508273-76508295 GCTGCTGATCTGACAGGAGATGG + Intronic
913524575 1:119678712-119678734 TCTGGTGGAGTGCCACCAGAAGG + Intronic
913539944 1:119809136-119809158 GCTTCAGGAGGGCCAGCAGAGGG + Exonic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
914950788 1:152111644-152111666 GCGGCTGAAGCGCCAGGAGGAGG - Exonic
915110831 1:153563887-153563909 GCTGCAGAGGTGCCAGGTGATGG + Exonic
915590693 1:156868563-156868585 GCTGCTGCGGTGCCAGGTGGAGG + Exonic
917440759 1:175066985-175067007 GCTGCTGGAGGGAAAGGAGAAGG - Intergenic
918016898 1:180643842-180643864 GCTGATGGAGTTCAAGTAGAAGG + Intronic
919773408 1:201177407-201177429 GATGCTGGAATGGCAGCAGATGG + Intergenic
920180969 1:204131509-204131531 CCTGCTGGGGGGACAGGAGAGGG - Exonic
922019353 1:221688162-221688184 GCTGTTGGAGTGCTAGCTGAGGG - Intergenic
922346275 1:224699364-224699386 GCTGCCGAAGGGCCAGGAGAAGG - Intronic
922593972 1:226799409-226799431 GCTGAGGGACAGCCAGGAGAAGG + Intergenic
923138494 1:231140124-231140146 GCTGCTGGAGGCCAAAGAGAAGG + Intergenic
923418746 1:233791283-233791305 GCTCCTGCAGTGCCACTAGAGGG - Intergenic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
924842732 1:247730760-247730782 GATGTTGGAGGGCCAGGAGAAGG + Intergenic
1062834795 10:628624-628646 GCGGACGGAGGGCCAGGAGAAGG + Intronic
1062886376 10:1019636-1019658 GCTGCTGGAGAGGGAGGCGAGGG - Exonic
1063121730 10:3109459-3109481 GCTGATGGAGTGCGTGCAGATGG + Exonic
1063288384 10:4714453-4714475 GGAGCAGGAGTGCAAGGAGACGG - Intergenic
1064694372 10:17950762-17950784 GCTGCTGGAGTGCCCGGGCTAGG - Intergenic
1066059805 10:31712894-31712916 GTGACTGGAGTCCCAGGAGAGGG + Intergenic
1066397539 10:35040890-35040912 GCTGCTGATGTGACAGGAGGCGG + Intronic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067170885 10:43904782-43904804 ACTTCTGGACTCCCAGGAGAAGG - Intergenic
1067272813 10:44806675-44806697 GCTGCTGTATTACCAGGACATGG - Intergenic
1068971080 10:62959142-62959164 CCTATTGAAGTGCCAGGAGAAGG - Intergenic
1069891145 10:71653150-71653172 TCTGCTGATGTGGCAGGAGAGGG - Intronic
1070328945 10:75404649-75404671 GCTGCTGGAATTAGAGGAGAGGG - Intergenic
1070748097 10:78947301-78947323 GCTGCTGGGCTGGCAGGGGAGGG - Intergenic
1070812515 10:79305542-79305564 TCTGCTGGAGGGCCTGGAGGTGG + Exonic
1071420512 10:85492653-85492675 GCTGCTGGAAGGGAAGGAGACGG + Intergenic
1071807966 10:89145102-89145124 GCGGCTGCAGTGGCAGGAAAAGG - Intergenic
1072409270 10:95184872-95184894 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1072812964 10:98477842-98477864 GCTGCTGGTCTGACAGGAGGTGG - Intronic
1073081283 10:100862588-100862610 GCTGCTGGTGTTCCAGCAGGTGG - Intergenic
1074280974 10:112051198-112051220 GATCCTTGAGGGCCAGGAGAAGG - Intergenic
1075326188 10:121533962-121533984 GCTGTTGGACTTGCAGGAGAGGG - Intronic
1075626797 10:123969720-123969742 GCACCTGGAATGCCAGGGGAGGG + Intergenic
1076370727 10:129951458-129951480 GCTGCTGCAGGGCCTGGGGAAGG + Intronic
1076666697 10:132097216-132097238 GCTGCTGTAGAGCCCGGAAATGG + Intergenic
1077079910 11:720677-720699 GCTGCTCGTGTGCCAGGACTCGG + Exonic
1077433405 11:2526941-2526963 GCGACCGGAGAGCCAGGAGATGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078568221 11:12435318-12435340 TTGGCTGGAGTGACAGGAGAAGG - Intronic
1081614877 11:44584908-44584930 GCAGGTGGAGTGCCTGCAGATGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083735082 11:64675590-64675612 GCTGCTGCAGAGCCAGGACTGGG + Intronic
1084377112 11:68784900-68784922 GCTGCTGAAGCCCCGGGAGATGG - Exonic
1084478239 11:69400922-69400944 CATCCTGCAGTGCCAGGAGAGGG - Intergenic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1084840665 11:71843832-71843854 GCAGCTGGAGTGCCAGGGCTGGG - Intergenic
1085515340 11:77108288-77108310 CATGCTGGGGTGCCAGGAAAGGG + Intronic
1086319163 11:85627468-85627490 GCTGCTTGAATGCGAAGAGATGG - Intronic
1087012297 11:93525560-93525582 CCTGCAGGAGAGCCAGGAGTGGG - Intronic
1088628099 11:111747378-111747400 GCTGCTACAGTGCTAGGAGAGGG - Intronic
1089284164 11:117394988-117395010 TCTGCTGGAGGTCCAGGTGAGGG + Exonic
1089287278 11:117415705-117415727 GCTGCTGGAGGGCCAAGACAAGG + Intergenic
1089640243 11:119843191-119843213 GCTCCAGGGGAGCCAGGAGAGGG + Intergenic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090228216 11:125084160-125084182 ACAGCTGGGGTGCCAGGCGAGGG + Intronic
1090915832 11:131161264-131161286 CCTGCTGACCTGCCAGGAGAAGG - Intergenic
1090976214 11:131682795-131682817 GCTCCTGGAGGCCCAAGAGAGGG + Intronic
1091277660 11:134363177-134363199 GCTGCTGGAGGGCAGGGACAGGG + Intronic
1091353166 11:134913836-134913858 GCTGGTGCAGTGGCAGCAGAGGG + Intergenic
1092241588 12:6839320-6839342 GCTGCAGGAGTCACAGGAGGAGG + Exonic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1094110190 12:26853928-26853950 CCTGCTGGATGGCCAGGAAACGG - Intergenic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096495495 12:52037264-52037286 GCTGCAGGAGCGCGAGGAGGAGG + Intronic
1096522377 12:52191650-52191672 GCAGCTGAAGAACCAGGAGAAGG - Exonic
1096553910 12:52391525-52391547 GCTGCTCGAGGCCCAGGAAACGG - Intergenic
1096771173 12:53936899-53936921 GCTGCTGGAGTCCAAGGTCAAGG - Intergenic
1096944224 12:55386305-55386327 GCAGCTGGAGATCCAGGAAAGGG - Intergenic
1097183666 12:57184975-57184997 TCTACTGGAGTGACAGGTGAGGG + Exonic
1098520786 12:71433133-71433155 GCTGCTGACCTGACAGGAGATGG - Intronic
1101773783 12:107775596-107775618 GCTGCTGGAGCGCCAGGCCTGGG + Exonic
1101783870 12:107864583-107864605 GCTGCTGGAGTGCCCGGGCTAGG + Intergenic
1103176631 12:118869595-118869617 GAAGCTAGAGTGCCTGGAGAGGG + Intergenic
1103209545 12:119156560-119156582 GCTGCTGCTGTACCAGGAGGAGG - Exonic
1103865355 12:124047433-124047455 GCTGCTGATCTGCCAGGAGGTGG - Intronic
1104301539 12:127569377-127569399 GCTGCTAGGGTGCCTGGAGGGGG - Intergenic
1104811296 12:131621868-131621890 GCAGCAGGAGAGCCAGGAGGAGG - Intergenic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1105015493 12:132784184-132784206 GCTGGAGGAGTCCCGGGAGAAGG - Exonic
1105299389 13:19118715-19118737 GTGGCTGGAGTGATAGGAGAAGG + Intergenic
1105407029 13:20141848-20141870 GCGACTGGAGTCCCAGGAGGTGG - Exonic
1106054966 13:26229212-26229234 GGTGCTGGGGTGCTAGGGGAGGG - Intergenic
1106324983 13:28680386-28680408 GAGGGTGGTGTGCCAGGAGAGGG - Intergenic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1107690280 13:42946775-42946797 GCTGCTGTTCTGACAGGAGACGG - Intronic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1108855476 13:54787856-54787878 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1108958257 13:56187769-56187791 GCTGCTGGAGTGCCCGGGCTAGG + Intergenic
1110134106 13:72044067-72044089 GATGCTGGAGTGAGAGAAGAGGG - Intergenic
1111390521 13:87588670-87588692 GGGGCTGGAGGGCTAGGAGAGGG + Intergenic
1112962199 13:105140179-105140201 GCAGCTGGAGACCCATGAGATGG - Intergenic
1113075074 13:106460171-106460193 ACTGCTGGAGGGCCAGAACAAGG - Intergenic
1114529308 14:23385921-23385943 GCTGCTGCATTCCCAGGTGAGGG - Exonic
1114566361 14:23635911-23635933 GCTGCTGGAGTGCCTGGGCTAGG + Intronic
1115091160 14:29577549-29577571 GCTGTTAGAGTGGAAGGAGAAGG - Intronic
1115398858 14:32937335-32937357 GCCGCGGGAGTGACAGGAGTGGG + Intronic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1118196001 14:63626795-63626817 GCTGATGGGGTGTCAGGAAATGG + Intronic
1118773387 14:68957365-68957387 ACTGCTAGAGTGGCAGGAGAGGG + Intronic
1120924356 14:89782938-89782960 GCTGCTGATCTGACAGGAGAAGG + Intergenic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1121320983 14:92991500-92991522 GCTGTGGGTGTTCCAGGAGAGGG - Intronic
1121339979 14:93099473-93099495 GCTGCCTGAGTTCCTGGAGAAGG - Intronic
1122098639 14:99389531-99389553 ACTGCTGGAGTGGCAGAGGAGGG + Intergenic
1122203336 14:100135923-100135945 GCTGCTCGGGTCCCCGGAGAGGG - Exonic
1122256316 14:100479817-100479839 GCTGCTGATCTGACAGGAGAAGG - Intronic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1123067577 14:105626306-105626328 GCTGCAGGGGTGCCTGCAGAAGG - Intergenic
1123071595 14:105645031-105645053 GCTGCAGGGGTGCCTGCAGAAGG - Intergenic
1123076555 14:105670086-105670108 GCTGCAGGGGTGCCTGCAGAAGG - Intergenic
1123091256 14:105743307-105743329 GCTGCAGGGGTGCCTGCAGAAGG - Intergenic
1123097030 14:105771647-105771669 GCTGCAGGGGTGCCTGCAGAAGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123665605 15:22607928-22607950 GCTGCTGGAGCTGCAGCAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123752151 15:23364724-23364746 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124319430 15:28702342-28702364 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124483086 15:30093089-30093111 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124489534 15:30145157-30145179 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124520497 15:30404129-30404151 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124538160 15:30562090-30562112 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124544626 15:30614151-30614173 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124564581 15:30801580-30801602 GCTGCTGGAGCTGCAGCAGATGG + Intergenic
1124612805 15:31220087-31220109 GCTGCTGGTCTGACAGGAGGCGG - Intergenic
1124636745 15:31370257-31370279 GCTTCAGCAGTACCAGGAGACGG + Intronic
1124753993 15:32393170-32393192 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124760493 15:32445495-32445517 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124778143 15:32603567-32603589 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1126191822 15:45886113-45886135 GCTGCTGGAGTGCCCGGGCTAGG + Intergenic
1127600982 15:60536707-60536729 ACTGCTGGCTTGCCAGGAAACGG + Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127931020 15:63597616-63597638 GCGGCTGGAGTGCCAGCAGATGG - Exonic
1128006469 15:64246733-64246755 GCTGCTGGGAAGCCAGGATATGG + Intronic
1128370536 15:67036017-67036039 GCTGGGGGAGGGCGAGGAGAAGG - Intergenic
1129169221 15:73797734-73797756 GCTGCAGGACTGGCAGGAGCGGG + Intergenic
1129319824 15:74768298-74768320 GCGGCTGGAGGGGAAGGAGATGG - Intergenic
1129330314 15:74823742-74823764 GCTGCTGAAGTGCTGGAAGAAGG - Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129484637 15:75858329-75858351 GCTGATAGAGTGCTAGGAGGTGG - Intronic
1129704198 15:77785253-77785275 GCTGCTTGAGGGCCAAGAGAGGG - Intronic
1130549547 15:84881261-84881283 GATCCTGTAGTTCCAGGAGATGG - Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1131239286 15:90724733-90724755 GAGGCTGGTGTGCCTGGAGAGGG - Intronic
1132427770 15:101733773-101733795 GCTGATAGAGTGCTAGGAGGTGG + Intergenic
1132616224 16:842281-842303 GTTGCTGCAGGCCCAGGAGACGG - Intergenic
1132687952 16:1170131-1170153 CCTGCAGGTGTGCCAGGGGAGGG + Intronic
1132973378 16:2699844-2699866 TGTGCTGCAGTGCCAGGAGGAGG + Exonic
1133775893 16:8894795-8894817 CCTGCTGGACATCCAGGAGAAGG - Exonic
1134516966 16:14895150-14895172 GCTGCAGGAGTGATAGCAGAGGG + Intronic
1134704636 16:16293804-16293826 GCTGCAGGAGTGATAGCAGAGGG + Intronic
1134962906 16:18418310-18418332 GCTGCAGGAGTGATAGCAGAGGG - Intronic
1134967201 16:18500909-18500931 GCTGCAGGAGTGATAGCAGAGGG - Intronic
1135827099 16:25738499-25738521 GCTGCTCTAGTGCCAAGAGAAGG + Intronic
1136153306 16:28366047-28366069 GCAGCTGGAGTTGGAGGAGAAGG - Intergenic
1136209780 16:28749220-28749242 GCAGCTGGAGTTGGAGGAGAAGG + Intergenic
1136302835 16:29347901-29347923 CATGCTGGAGTGCCAGGGCACGG - Intergenic
1136398879 16:30007138-30007160 GCTGCAGGGGCGCCAGGGGAGGG - Intronic
1138455230 16:57117135-57117157 GCTGCCGCAGGGGCAGGAGAAGG + Intronic
1138508179 16:57489420-57489442 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1140114100 16:72026717-72026739 GCTGCTTGAGCACCAGGATAAGG + Intronic
1141181075 16:81753841-81753863 GCAGCTGGAGGGCTGGGAGAGGG + Intronic
1141531550 16:84649562-84649584 GATGCTGGAGAGCCCAGAGAGGG - Intronic
1141794471 16:86261134-86261156 GCTGCAGCAGTTCCAGGACAGGG - Intergenic
1141948204 16:87324542-87324564 GGTGCTGGAGGGCCAGGGGGAGG - Intronic
1142319745 16:89373429-89373451 GGTGCTGGCGTGGCTGGAGAGGG - Intronic
1142767112 17:2071115-2071137 GCAGCTGGAGTGACAGGGGCTGG + Intronic
1143372216 17:6447498-6447520 GCTGGTGGAGACCCAGGTGAAGG + Exonic
1144676344 17:17164663-17164685 GCTGCTGGAGAGCTGTGAGAAGG + Intronic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1145358918 17:22194495-22194517 GCTGAAGGAATGCCAGGGGAAGG - Intergenic
1145404092 17:22570676-22570698 GCGGCTGGAGTGGTAGGAGACGG + Intergenic
1145722807 17:27089083-27089105 GCGGCTGGAGCGGTAGGAGAAGG - Intergenic
1145840307 17:27988948-27988970 ACTGCTGGAGTGCCACCACAAGG + Intergenic
1145995698 17:29103631-29103653 GCTGCTGGAGTGCTTGGATCTGG - Exonic
1147598866 17:41733849-41733871 TCTACCGCAGTGCCAGGAGAGGG - Intronic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148115253 17:45171592-45171614 GCTGCTGGAGTGTCGGGGGAGGG + Intergenic
1148998144 17:51730113-51730135 GCTGATGTTGTGCTAGGAGAAGG - Intronic
1149491851 17:57090921-57090943 GCCTTTGGAGGGCCAGGAGATGG - Intronic
1151408913 17:73907747-73907769 GCACCGGGAGTGCCAGGAGGTGG + Intergenic
1151758425 17:76087678-76087700 GCTTTTGGACTTCCAGGAGACGG - Exonic
1151810934 17:76441436-76441458 GCTGCAGGAGGGGCAGGAAAGGG - Intronic
1151845541 17:76652005-76652027 GCTGCTGGAGTCCACGGAGGAGG + Intergenic
1151873408 17:76851698-76851720 GCTGCTGGAGACCCAGGAAATGG - Intergenic
1151966792 17:77435735-77435757 GCTGCAGGACAGCCAGGAGGAGG - Intronic
1152225966 17:79092979-79093001 CCTGCTGGGGTGCGAGGAGGTGG - Intronic
1152279109 17:79374988-79375010 GCTGGTGGAGCGGCAGGGGAAGG - Intronic
1152317253 17:79588416-79588438 GCTCCTGGAGTGGCAGGAGGAGG - Intergenic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152753530 17:82077551-82077573 CCTGCTGGAGAGGCAGGGGAGGG - Intergenic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153687387 18:7560095-7560117 GATGCAGGAGTGCAAGGAGAGGG + Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1156270019 18:35522035-35522057 GCTGCTGGAGTGGCAGGAAGGGG + Intergenic
1157221218 18:45829576-45829598 ACACCTGGAGGGCCAGGAGAGGG - Intronic
1158970790 18:62664399-62664421 GCCCTTGGACTGCCAGGAGATGG + Intergenic
1159153550 18:64553024-64553046 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1160163358 18:76491634-76491656 GTTGCTGGGCTGCCAGGAGGAGG - Intronic
1160498290 18:79388020-79388042 GCTGGTGGAGTGGCAGGGGGAGG - Intergenic
1160752558 19:741384-741406 GCTGCAGGAGTGAGGGGAGACGG + Intronic
1160810605 19:1011387-1011409 GGTGCTGGTGTGGCAGCAGATGG + Exonic
1161209115 19:3057113-3057135 GCTGCTCGAGGGCCAGGCCAAGG + Intronic
1161421193 19:4176812-4176834 GCTACAGCAGTGCCAGGACACGG + Intronic
1161719883 19:5896853-5896875 GCTGGGGCTGTGCCAGGAGAGGG + Intronic
1161933573 19:7357211-7357233 GCAGCTGGAGTGCCTGGGGAGGG + Intronic
1161937870 19:7383150-7383172 GCAGCTGGAGGGGCCGGAGAAGG - Exonic
1161988845 19:7672584-7672606 GCTGCTGGTCTGACAGGAGGTGG + Intergenic
1162364133 19:10237799-10237821 GCTGCTGGATTGAGAGGAGCCGG - Intergenic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162754878 19:12852020-12852042 GCTGCTGGAGTGCCTGGTGAGGG + Exonic
1163322198 19:16581399-16581421 GGTGCTGGAGTGCCTGGGGCAGG - Intronic
1163435491 19:17292759-17292781 GATGCTGGAATGCCCTGAGACGG - Exonic
1163435499 19:17292807-17292829 GCTTCAGGAATGCCAGGAGCAGG + Exonic
1163597981 19:18231534-18231556 GCTGCTGGAGGGCCAGGCTGGGG + Intronic
1163758116 19:19118998-19119020 CATGAGGGAGTGCCAGGAGAAGG - Intergenic
1164014180 19:21237471-21237493 ACTGCTGGAGTGCCAGGGTCAGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1165138527 19:33685734-33685756 GCAGCTGGACTCCCAGGAGAGGG + Intronic
1165210356 19:34230992-34231014 GCTGCTGATGTGACAGGAGGTGG + Intergenic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167586959 19:50380754-50380776 GCAGCTGGAGCACAAGGAGATGG + Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167750769 19:51378957-51378979 GTCGCTGGAGTCCGAGGAGACGG - Intergenic
1168268945 19:55239355-55239377 GCTGCTGCAGAGGCAGGACAGGG + Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925831859 2:7903745-7903767 GATGGGGGACTGCCAGGAGATGG - Intergenic
926710389 2:15874907-15874929 GAACCTGGAGTGCCAGGAGTGGG + Intergenic
927056193 2:19367614-19367636 CCTGCTCTGGTGCCAGGAGAGGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927516521 2:23674906-23674928 GCTGGGGGAGGGCCAGGTGAGGG - Intronic
927672649 2:25082063-25082085 GCTGCTGGTGGCCCAGGTGAGGG + Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928504939 2:31941195-31941217 GCAGCTGGAGTGGCAGTACAAGG - Intronic
928641446 2:33303744-33303766 GCTGCTGATCTGTCAGGAGATGG + Intronic
928793870 2:34992194-34992216 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
929083626 2:38146750-38146772 GCTGCGGGGGTGGCGGGAGAAGG - Intergenic
929895884 2:45960572-45960594 GCTGCTGGTCTGACAGGAGGTGG + Intronic
931880883 2:66569454-66569476 TCTGCAGCAGTGCAAGGAGAGGG + Intronic
931933045 2:67162358-67162380 GCAGATGGAGGGCCAGGGGAGGG + Intergenic
932536549 2:72603358-72603380 GGTGCTGGGGGGCCAGGGGAGGG - Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
935149895 2:100424569-100424591 GCAGCATGAGTGCCAGGAGGTGG + Intergenic
935420674 2:102865832-102865854 GCTGCAGGAATGCCGGGGGAAGG + Intergenic
935711861 2:105906107-105906129 ACTGCTGGTCTCCCAGGAGAAGG - Intergenic
935878669 2:107538958-107538980 GCTGCTGGAGAGTTGGGAGAGGG + Intergenic
936258367 2:110936003-110936025 GCTGCTGAACTGACAGGAGGTGG + Intronic
937014223 2:118588971-118588993 GCTGCTGATCTGACAGGAGATGG + Intergenic
937748587 2:125446126-125446148 TCTTCTGGAATGACAGGAGAGGG - Intergenic
938312132 2:130300380-130300402 GCGGCTGGAGTGGTAGGAGAAGG - Intergenic
940001029 2:148966302-148966324 GCTGCTGGAGAGCAAGGAAGGGG + Intronic
940908704 2:159191400-159191422 TCTGCTCCAGTGCCAGGACATGG - Intronic
942420425 2:175801491-175801513 GCTACTGAAGTGACAGGAGGTGG + Intergenic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
944302770 2:198143309-198143331 GCTGCTGATGTGACAGGAGTGGG + Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
944711190 2:202336378-202336400 GCTGGTGGAGACCCAGGTGAAGG - Intergenic
944766716 2:202871709-202871731 GCTGCCGGAGGGCCGGGAGTCGG - Intronic
944772200 2:202925750-202925772 GCTGCTTGAGTAACAGGAGCTGG + Intronic
945503884 2:210613847-210613869 CCTGCTCGAGTGCTGGGAGAAGG + Intronic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946295126 2:218777924-218777946 GGAGGTGGAGTGGCAGGAGATGG + Intergenic
946431449 2:219628954-219628976 TCTGGTGGAGTGGGAGGAGAGGG - Intronic
1171233959 20:23509561-23509583 GCTGCTGGCCTCCCAGGAGTGGG + Intergenic
1171467215 20:25338219-25338241 GCTGGTGGAGTGGGAGGAGGAGG - Intronic
1172029735 20:31973522-31973544 GCTACTGGAGTGCCAGGGAGAGG + Intronic
1172033496 20:31996913-31996935 GCGGCTGGAGTACCAGAAGCCGG - Exonic
1172504565 20:35452001-35452023 GCTGCTGAACTGACAGGAGGTGG - Intronic
1172606350 20:36216797-36216819 GGGGCTGGAGTGCAAGGAGGTGG + Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1172828103 20:37807393-37807415 ACTGTGGGAGGGCCAGGAGAGGG + Intronic
1173061613 20:39667020-39667042 GCTGATGCAGTGCCAGGGCATGG + Intergenic
1173086436 20:39923453-39923475 GCTAATGGAGTGAGAGGAGAGGG - Intergenic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1174194853 20:48765922-48765944 GCTGCTGATGTGACAGGAGGCGG - Intronic
1174629001 20:51940209-51940231 GCAGCCGGAAAGCCAGGAGAGGG + Intergenic
1174713104 20:52728149-52728171 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175367833 20:58467658-58467680 GCTGCAGGGGTGGAAGGAGATGG + Exonic
1175465834 20:59191074-59191096 GCCCCTGGAGGGCCAGGAGTGGG - Exonic
1175515513 20:59567445-59567467 CCTGCTGCACAGCCAGGAGAGGG - Intergenic
1175704365 20:61165234-61165256 GCTGCTGGAATGCTAGGGGAAGG + Intergenic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1176088752 20:63309736-63309758 GCTGCTGGAGTAGCGGGAGTGGG - Exonic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176649096 21:9529470-9529492 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1177682479 21:24390607-24390629 GCTGCTGGAGTCCTTGGAAATGG - Intergenic
1177791565 21:25728028-25728050 GCTGCTGGAGAGGAAGAAGAGGG - Intronic
1178763672 21:35428815-35428837 GCTGCTTGTGGGCCAGGTGATGG + Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179942144 21:44647237-44647259 GCAGCTGGACTGGCAGGAGGAGG - Exonic
1179949664 21:44702683-44702705 GCAGCTGGGCTGGCAGGAGAAGG - Intronic
1180079748 21:45481195-45481217 ATTGCTGGAGGGCCAGGGGAGGG + Intronic
1180796773 22:18609673-18609695 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181224951 22:21385598-21385620 GCGGCGCGAGTGCCAGGAGCTGG + Exonic
1181253681 22:21549215-21549237 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1181959300 22:26611370-26611392 GCAGCTGGACGCCCAGGAGAGGG + Intronic
1182442792 22:30373925-30373947 GCTGCTGCAGAGCCTGCAGAGGG + Exonic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1182593612 22:31400722-31400744 GGTGGTGGAGGTCCAGGAGAAGG + Exonic
1182693709 22:32181700-32181722 TCTGCTGGAGTGACTGGAGGAGG - Intergenic
1183300645 22:37057421-37057443 CGTGCTGCAGTGCCAGGAGGAGG + Exonic
1183736674 22:39648396-39648418 GGGGCAAGAGTGCCAGGAGAGGG - Intronic
1184531118 22:45056325-45056347 GCGGTTGGATTGGCAGGAGAAGG - Intergenic
1184693808 22:46129085-46129107 AGGGCTGGGGTGCCAGGAGAAGG - Intergenic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185267219 22:49910713-49910735 GCTGCTGCAATGCCAGCTGACGG + Intronic
1185365919 22:50436704-50436726 GCTCCTGGAGTGGGAGGAAAGGG - Intronic
1185418661 22:50723102-50723124 GCAGATGGAGTGCAGGGAGATGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950298268 3:11850832-11850854 GCTGATGGAGGGGAAGGAGAGGG + Intergenic
950554293 3:13685957-13685979 GCTGCTGGGAGGCCAGGAAATGG + Intergenic
950703326 3:14765516-14765538 GCATCTAGAGTGCTAGGAGAGGG + Intronic
950900725 3:16495024-16495046 GCGGGTGGAGTGGAAGGAGACGG + Intronic
951361356 3:21728135-21728157 GGTGGTGGAGGGCTAGGAGAGGG + Intronic
953885438 3:46712272-46712294 GCAGTGGGAGTGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954224933 3:49175244-49175266 ACCCCTGGAGTGCCTGGAGATGG - Intronic
954266218 3:49472168-49472190 GCTGGTGGAGTGGCAGGAAGAGG + Intronic
954493588 3:50930929-50930951 CCTGCAGCAGTGGCAGGAGAGGG + Intronic
954715257 3:52523732-52523754 GCTGTGGGGGTGCCAGGAGGGGG - Exonic
956638394 3:71390189-71390211 GCTGCTGGGATGCAAGGTGAAGG - Intronic
956646966 3:71465824-71465846 GCTGCTGATGTGACAGGAGGCGG - Intronic
958892112 3:99794694-99794716 CCTGTTGGACTGCCAGGAGTGGG + Exonic
961001838 3:123379283-123379305 GCTGGTGGAGTTCCAGGGGTTGG + Intronic
961038446 3:123660048-123660070 GCTGCTGAAGTCCCAGGGAAGGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962299134 3:134222082-134222104 GCTGCTGTGGTGAAAGGAGATGG - Intronic
962456849 3:135572778-135572800 GCTGCTGGAGAGCGAGGACAGGG - Intergenic
962693189 3:137921821-137921843 GCTGCTTGAAGGACAGGAGAAGG - Intergenic
963190408 3:142464694-142464716 GCTGCTGGAGGCTGAGGAGAAGG + Intronic
963428088 3:145157665-145157687 GGGGCTGGAGGGCAAGGAGAGGG + Intergenic
964130545 3:153281550-153281572 GCTGCTGGAGTGCCGGGGCTAGG + Intergenic
964677287 3:159297807-159297829 CCTGATGGAGTGACAGGATAAGG - Intronic
965139868 3:164818620-164818642 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
965363847 3:167774618-167774640 GCTGCTGGTCTGACAGGAGGTGG - Intronic
965867721 3:173225819-173225841 GATGGTGGAGTGCCTGGAGAGGG - Intergenic
965890050 3:173501250-173501272 GCTGGTGGACTGCCGGGGGAGGG - Intronic
966473958 3:180322985-180323007 GCAGCCTGAGTGCCAGGAGGCGG + Intergenic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967516979 3:190381441-190381463 GAAGCTGGAGTGGCAGGTGATGG - Intronic
968646607 4:1744248-1744270 GCTGCAGGTGTGGCAGGAGGGGG + Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
968805153 4:2767432-2767454 GGGGGTGGGGTGCCAGGAGAGGG + Intergenic
969203278 4:5622649-5622671 GCAGCTGGAGGGGGAGGAGAGGG - Exonic
969283789 4:6189920-6189942 GCTGCAGGCGTGGCAGGAGAGGG + Intronic
969308849 4:6340535-6340557 GCTGCTGGATTGGATGGAGAGGG - Intronic
969762752 4:9201415-9201437 GTATCTGGAGTGGCAGGAGAGGG + Intergenic
969781761 4:9409825-9409847 GCTGCTGGAGTGCCAGGGCTGGG - Intergenic
970645167 4:18111581-18111603 GCTACTGGAGGGCCTGGAGAAGG - Intergenic
971879499 4:32351862-32351884 GCTGCTGATCTGACAGGAGATGG + Intergenic
976406835 4:84669064-84669086 GCTGCTGTAGTTCCAGGTGAGGG + Intergenic
976569815 4:86594743-86594765 GCTACTGGAGCGCCGGGCGAGGG - Exonic
976830033 4:89305338-89305360 GCTGGTGGAGTGCCCTGACAGGG - Intronic
977266315 4:94859911-94859933 GCTCCTGGAGACCCAGGAAAAGG - Intronic
977585774 4:98773901-98773923 GAGGCAGGAGGGCCAGGAGATGG - Intergenic
978159316 4:105527046-105527068 GCTGGTGGAGACCCAGGTGAAGG - Intergenic
978410356 4:108418347-108418369 GCTTCTGGACTTCCAGGAGATGG - Intergenic
979330798 4:119419860-119419882 GCTGCTGGTCTGACAGGACATGG + Intergenic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
980696002 4:136356210-136356232 ACTGCTCGAGTGCCAGGTGCAGG - Intergenic
982235621 4:153249025-153249047 GTTGCTGGAGGGCCAGGCGGGGG + Intronic
982318554 4:154056958-154056980 GGTGCTGGAGACCCAGGACAGGG + Intergenic
982701784 4:158665089-158665111 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
982767875 4:159368741-159368763 GCTGCTGGTCTGACAGGAGACGG - Intergenic
983874425 4:172859759-172859781 GCTGCTGATCTGACAGGAGATGG - Intronic
984366252 4:178803656-178803678 TCTGCTGGAGTGCCTGGAAGGGG + Intergenic
984961488 4:185102052-185102074 GCTGCTGCGGAGCCAGGAAATGG - Intergenic
985445457 4:190019004-190019026 GGAGCTGGAGAGCCAGGGGAAGG + Intergenic
987282616 5:16426213-16426235 GCAGCTGTGGTGGCAGGAGAGGG + Intergenic
988730809 5:33970907-33970929 GCTGCCAGAGTGCATGGAGATGG + Intronic
990980825 5:61601216-61601238 GCTGCTGGAATGCAGGAAGAGGG + Intergenic
991120581 5:63008499-63008521 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
991593609 5:68279679-68279701 GCTGCTGGAATGACAGGATTTGG - Exonic
992807482 5:80351806-80351828 GACGCTGGAGGGCCGGGAGAAGG - Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
994843590 5:104956830-104956852 GCTTCTAGAGTGGCAGGATAGGG + Intergenic
994985184 5:106924098-106924120 GCTGCTGGTCTGACAGGAGGTGG - Intergenic
995445552 5:112239003-112239025 GCAGCTAGAGCGCCAGGGGATGG + Intronic
997900603 5:137760459-137760481 GCTGCTGCTGTGACAGTAGACGG + Intergenic
997963710 5:138341230-138341252 GGTGCTGCAGTGGCAGAAGACGG + Exonic
998385900 5:141756977-141756999 GGTGCGGGAGTGTCAGGAGCAGG - Intergenic
999883907 5:155898787-155898809 GCAGTTGGAGTGGCAAGAGAAGG + Intronic
1001054717 5:168439580-168439602 GCTGCTGGAGTGCAATGGCATGG - Intronic
1001113868 5:168922627-168922649 GATGCTGGAGTGCCAGGGAAAGG + Intronic
1001865007 5:175096248-175096270 GCTGCGGTGGTGGCAGGAGAGGG + Intergenic
1001971397 5:175957558-175957580 GCAGCTGGAGTCCTGGGAGAGGG - Intronic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002246045 5:177886219-177886241 GCAGCTGGAGTCCTGGGAGAGGG + Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002560486 5:180078595-180078617 GCTGCTGATGTGACAGGAGGTGG - Intergenic
1002580964 5:180209221-180209243 GCTGCCTGAGTGCCACGAGGGGG - Intergenic
1002688324 5:181032613-181032635 GCTGCTGGAGTGCCCGGGCTGGG + Intergenic
1003125460 6:3352074-3352096 GCTGCTGGAGTGCTGAGAGGTGG + Intronic
1003516767 6:6824653-6824675 GCTGCTTTAGCCCCAGGAGAGGG - Intergenic
1004196820 6:13512731-13512753 GCTGCTGGAGTGCCTGGACTAGG + Intergenic
1004517343 6:16331502-16331524 GCTGCAGGAGGGCCAGCAGGGGG - Intronic
1004897131 6:20159293-20159315 GCTGCTGATCTGACAGGAGATGG - Intronic
1006221429 6:32495365-32495387 GCTGCTGGAGTGCCAGGGCTGGG - Intergenic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006514741 6:34539559-34539581 GCCGCTGCAGGGCAAGGAGAGGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1009690932 6:67031198-67031220 GCTGCTGGAGTGCCTGCACTAGG + Intergenic
1011821677 6:91260557-91260579 GAGGGTGGAGTGCCAGAAGAAGG + Intergenic
1011825732 6:91303347-91303369 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1013321683 6:108997320-108997342 GTTGCTAGAATGCTAGGAGATGG - Intronic
1014615234 6:123590225-123590247 GCTGCTGATCTGACAGGAGATGG - Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1016183529 6:141175242-141175264 GCTGCTGGAGTGCCCGGGCTAGG + Intergenic
1017017776 6:150115847-150115869 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1017070405 6:150570923-150570945 GCTGCTGCAATGCTAGGAGGAGG - Intergenic
1018830117 6:167435584-167435606 GCTGCTGCTGTGCTCGGAGAGGG + Intergenic
1018894343 6:168002967-168002989 GCTGCTGGTCTGACAGGAGGTGG + Intronic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019291324 7:251952-251974 GCGGCTGGAGTGGCAGCAGTGGG - Intronic
1019406434 7:886598-886620 GGTCCTGGAGTCCCTGGAGAAGG + Exonic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019659671 7:2217119-2217141 GCTGCTAGAGTGGCAGAAGTGGG - Intronic
1020039853 7:4993644-4993666 GCTGCTGGTGTGGCAGCAGGAGG + Intronic
1020077657 7:5269106-5269128 GGTGCTGAGCTGCCAGGAGATGG - Intergenic
1022970936 7:35516594-35516616 CCTGCTGGACTGCCTGGAGCTGG - Intergenic
1023522220 7:41060022-41060044 GCTTCAGGTGTGGCAGGAGAAGG + Intergenic
1023888642 7:44377518-44377540 GCTGCTGGAGCCCCATGGGAAGG - Intergenic
1026217005 7:68358474-68358496 GCTGCTGGGGTGGCAGATGAGGG + Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1028567094 7:92245808-92245830 GGTGCTGAGGTGCGAGGAGAGGG - Intronic
1029110901 7:98212537-98212559 GCGGCTGGAGAGCAACGAGAGGG + Exonic
1029127714 7:98306205-98306227 GCTGCAGGACTGCGAGGAGTAGG + Intronic
1029251933 7:99243182-99243204 CCCTCTGGAGTCCCAGGAGATGG - Intergenic
1029255647 7:99267731-99267753 GATGCTGCAGGGCCAGGAAATGG - Intergenic
1029543163 7:101196423-101196445 GCTGCTGGACTGCTCCGAGATGG + Intronic
1031649486 7:124269630-124269652 GCTGCTGAAGTGCCTGGATTTGG + Intergenic
1032293549 7:130613264-130613286 GCTGCTGGTCTGGCAGGAGGCGG + Intronic
1033951285 7:146788098-146788120 GCTGCTGGAGTGCCTGGGCTAGG - Intronic
1034193206 7:149226471-149226493 GTTGCAGGAGTGTGAGGAGAGGG + Intergenic
1034276954 7:149828072-149828094 GCTGCTGCAGGGCCTGGAGTAGG - Intergenic
1034966108 7:155392142-155392164 GCTGGTGAGGTGGCAGGAGAAGG - Intronic
1036226261 8:6960259-6960281 GATGCTGCAGTGACAGGAGGTGG + Intergenic
1036837663 8:12088905-12088927 GCTGCTGGAGTGCCAGGGCTGGG + Intergenic
1036859456 8:12335153-12335175 GCTGCTGGAGTGCCAGGGCTGGG + Intergenic
1036962683 8:13262587-13262609 CCTGCCTGAGTGCCAGGACAAGG - Intronic
1037751812 8:21687130-21687152 GCTGCTGGAGACGGAGGAGAAGG + Intergenic
1037807027 8:22063759-22063781 CCTGCTGGGGTGTCAAGAGAGGG - Intronic
1037841483 8:22248330-22248352 GCTTCTGGGGAGCCAGGTGAGGG + Intronic
1038021038 8:23551972-23551994 GATCCTGGAGTCCCAGGAGGAGG - Intronic
1038541039 8:28390237-28390259 GCATCTGGAGTGCCATGTGAGGG - Intronic
1039070716 8:33647176-33647198 GCTGCTGGTCTGACAGGAGGCGG + Intergenic
1041706681 8:60853520-60853542 GCTGCTGCAGGGTCAGGAGAGGG - Intronic
1042829260 8:73009015-73009037 ACTGCTCGAGTGCCAGGTGCAGG + Exonic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1043119321 8:76302787-76302809 GCTGCTGATCTGACAGGAGACGG + Intergenic
1043445248 8:80313204-80313226 GCTGCTGATCTGACAGGAGATGG + Intergenic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1045653417 8:104363988-104364010 GCTGCTGGAGTGCCTGGGTTGGG - Intronic
1046876448 8:119259914-119259936 GCTGCTGGGTTGACAGTAGATGG + Intergenic
1047651389 8:126926445-126926467 GAAGCTGGAGTGACAGGATATGG - Intergenic
1048354211 8:133640341-133640363 GCTACTGGAGTGCACTGAGATGG - Intergenic
1048515983 8:135111965-135111987 TCTGCTGGAGTGCCCACAGAAGG - Intergenic
1048867056 8:138769002-138769024 GGGGCTGGAGAGACAGGAGATGG - Intronic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049642868 8:143723260-143723282 GGTGTTGGGCTGCCAGGAGAGGG + Intergenic
1050258796 9:3819525-3819547 GATGTTGGTGTGGCAGGAGAAGG - Intergenic
1050848568 9:10255997-10256019 GCTGCTGAACTGACAGGAGGTGG - Intronic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1053556774 9:39145635-39145657 AGTGCTGGAGAGCCAGGATAGGG - Intronic
1053820883 9:41965913-41965935 AGTGCTGGAGAGCCAGGATAGGG - Intronic
1054089753 9:60834052-60834074 AGTGCTGGAGAGCCAGGATAGGG - Intergenic
1054111164 9:61109610-61109632 AGTGCTGGAGAGCCAGGATAGGG - Intergenic
1054609693 9:67221515-67221537 AGTGCTGGAGAGCCAGGATAGGG + Intergenic
1055429659 9:76230676-76230698 GCTGCTGATGTGACAGGAGATGG - Intronic
1056014024 9:82363312-82363334 GATGCAGGGGTGCCAGAAGAGGG + Intergenic
1056738745 9:89234593-89234615 GCTCCTGGAGTGCAGGGTGAGGG - Intergenic
1058149019 9:101443601-101443623 CCTGCTGGAGTGCCAGCAATTGG - Intergenic
1059358516 9:113720057-113720079 GAGGCGGGAGTGCCAGGAGGTGG - Intergenic
1059415131 9:114157489-114157511 GCTGGTGGAGGCACAGGAGAGGG - Intronic
1060904904 9:127296117-127296139 GCTGCTGATCTGACAGGAGACGG + Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061203680 9:129151073-129151095 GCCGCTGGGGTGCCAGCAGCAGG - Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061654664 9:132079694-132079716 GACGCTGGAGGGCCGGGAGAAGG - Exonic
1061924194 9:133798007-133798029 GCTGCCGGCGTGCTGGGAGAGGG + Intronic
1062279671 9:135746381-135746403 GTTTCTGGGGTGCCAGGAGGAGG + Intronic
1203626832 Un_KI270750v1:33018-33040 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1186191007 X:7067613-7067635 GCAGCTGTAGTGGCAGGAGATGG + Intronic
1187285503 X:17899728-17899750 GCTGCTGCAGTGGCAGTAGGCGG - Intergenic
1188356623 X:29199661-29199683 GCTGCTGATGTGACAGGAGGCGG + Intronic
1190509749 X:51163008-51163030 GCTGCTCGAGAACCAGAAGAAGG + Intergenic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic
1192588744 X:72342029-72342051 GCAGCTGAAGTGCCTAGAGACGG - Intronic
1193620695 X:83749975-83749997 ACTGCTCGAGTGCCAGGTGCAGG - Intergenic
1193962163 X:87939726-87939748 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1194909133 X:99617676-99617698 GGGGTTGGAGTGCAAGGAGAGGG - Intergenic
1195539434 X:106045830-106045852 CCAGCTGGAGTCCCAGAAGAAGG - Intergenic
1196741297 X:119028466-119028488 GCTGCCGGAGTGCCAGGGCTAGG - Intergenic
1197078944 X:122388960-122388982 GCTGCTGGAGTGCCTGGGCTGGG - Intergenic
1199978312 X:152907174-152907196 GGTGCTGGAGCGTGAGGAGATGG - Intergenic
1200112935 X:153752091-153752113 GCTGCTGATCTGCCAGGAGATGG - Intergenic
1200183034 X:154162917-154162939 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200188688 X:154200031-154200053 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200194337 X:154237172-154237194 GCTGCCAGAGGGCCAGGAGATGG - Intergenic
1200200093 X:154274975-154274997 GCTGCCAGAGGGCCAGGAGATGG - Intronic
1201712903 Y:17012108-17012130 GCTGCCAGAATGCCAGGAGGAGG - Intergenic
1201867877 Y:18673788-18673810 GCTGCTGGAGGGCGAGGACGCGG - Intergenic