ID: 1127796663

View in Genome Browser
Species Human (GRCh38)
Location 15:62444174-62444196
Sequence CAGGGAAATATTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127796651_1127796663 19 Left 1127796651 15:62444132-62444154 CCTATAAAGAAGTCTGAGAAGCC 0: 1
1: 0
2: 5
3: 16
4: 178
Right 1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 416
1127796656_1127796663 -2 Left 1127796656 15:62444153-62444175 CCAGAGAGGGAGAAGGCAGGCCA 0: 1
1: 0
2: 3
3: 49
4: 438
Right 1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 416
1127796650_1127796663 28 Left 1127796650 15:62444123-62444145 CCGTTTGAACCTATAAAGAAGTC 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127796663 Original CRISPR CAGGGAAATATTGAGGAGGA GGG Intronic
900571822 1:3362420-3362442 CAAGGAAATATAAAGGAGGCTGG + Intronic
901104399 1:6743993-6744015 CTGGCAAACATTAAGGAGGAAGG - Intergenic
902895210 1:19474979-19475001 CAGGGAGCTATGGAGGAGGCGGG + Intronic
903848194 1:26290804-26290826 CAGGGAAGTAGTGAGGAGTGAGG + Intronic
904485731 1:30823620-30823642 CAGGGAAGCTTTGTGGAGGAGGG - Intergenic
906234585 1:44197556-44197578 AAAGTAAATATTGAGGAGAAAGG - Intergenic
906529403 1:46514867-46514889 CAGGAAAAAAGTGAGCAGGATGG + Intergenic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907974514 1:59418461-59418483 AAGGGAAAGAGTGAGCAGGAAGG + Intronic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
909961356 1:81847687-81847709 GAGGGAAATATTAGGGAGAAAGG - Intronic
910835014 1:91500226-91500248 GAGGGAAATACTGACCAGGAAGG - Intergenic
912599258 1:110911459-110911481 CTCAAAAATATTGAGGAGGAGGG + Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
916719565 1:167474089-167474111 GAGAGAAATATTTAGGAAGAAGG - Intronic
918393516 1:184090925-184090947 CAGGGACATATTGGAGAGGGAGG + Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920661596 1:207920239-207920261 CTGTGAAACATTGAGTAGGAAGG + Intergenic
922985045 1:229859981-229860003 CAGGGGAAGATTGAGGTTGAGGG - Intergenic
923569489 1:235101262-235101284 CTAAGAAATATTGAGAAGGAGGG + Intergenic
923931715 1:238706968-238706990 AAGGGAAATTTTGAGGAGCTAGG + Intergenic
923941304 1:238830666-238830688 CAGGAAAATATTGAATAGTAGGG - Intergenic
1063720332 10:8574120-8574142 AAGGGAAATATGAAAGAGGAAGG + Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064962258 10:20978201-20978223 CAGGGAAGTGTTGGGGAAGATGG - Intronic
1068444477 10:57103618-57103640 AAGGGAAAGAGTGAGCAGGATGG + Intergenic
1068699536 10:60004963-60004985 CAGGGAAATATATCTGAGGAAGG - Intergenic
1068809007 10:61234773-61234795 AAGAGAAATAGTGGGGAGGAAGG - Intergenic
1069154765 10:65014128-65014150 CAGGAAAATATAGCGGAGTAGGG - Intergenic
1069227539 10:65962505-65962527 TAGGGCAATATTGATGAGAATGG - Intronic
1069652993 10:70064691-70064713 CAAGAAAAAAATGAGGAGGAAGG - Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070635365 10:78122203-78122225 TGTGGACATATTGAGGAGGAGGG - Intergenic
1070943208 10:80365602-80365624 CAGGCAAAGATTGAAGTGGAGGG + Intronic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071888304 10:89974567-89974589 CAAAGAAATAATGAGGAGGCTGG + Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1072946255 10:99812483-99812505 CAGTCAAATATTTAGGAGAAGGG + Intronic
1073475774 10:103752131-103752153 CAGGGAAACATTCAGGACAAGGG + Intronic
1073519627 10:104115288-104115310 GAGGGAAGAATTGAGGAGGTAGG - Intergenic
1073816273 10:107211167-107211189 CAAAAAAAAATTGAGGAGGAGGG - Intergenic
1074612285 10:115033847-115033869 CAGAGAAAATTCGAGGAGGAGGG - Intergenic
1075924515 10:126239976-126239998 CACGGAAGGATGGAGGAGGAGGG - Intronic
1076030004 10:127149409-127149431 CATGGAAATATAGAGGACTAGGG - Intronic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1079801255 11:24872131-24872153 TAGAGAGATATTGAGAAGGATGG - Intronic
1080427731 11:32171765-32171787 TAGAGAAATAGTGAGTAGGAGGG + Intergenic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1080583651 11:33663470-33663492 CAGGGCAATATTCAGCAGCAGGG - Intronic
1081059994 11:38462215-38462237 CAGAGAAATAGAGAAGAGGAGGG - Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081669311 11:44934372-44934394 GAGGGCCAGATTGAGGAGGAGGG + Exonic
1082200737 11:49363614-49363636 CAGAAAAATAATGAGGAGTAAGG - Intergenic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083356284 11:62068725-62068747 CAAGGAAATATTTAGGATAAGGG + Intergenic
1084951745 11:72670215-72670237 CAGGAAGGTATTTAGGAGGAGGG - Intronic
1085309369 11:75507110-75507132 CAGGGAAAGAAAGAGGAGAAGGG + Intronic
1085522569 11:77146969-77146991 CTGGGGAATATTGCGGAGTAAGG + Intronic
1087250319 11:95891741-95891763 CAGGCAAATATTGAACTGGAGGG + Intronic
1088455198 11:110026035-110026057 CAGCCAAATATTTAGGAAGAGGG + Intergenic
1089169879 11:116504577-116504599 AAGGGAAATATTGCTGGGGATGG + Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1090132533 11:124159705-124159727 GAGGGAAATGAAGAGGAGGAGGG - Intergenic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091547374 12:1510407-1510429 AAAGGAAATACTGAGGAGGGAGG + Intergenic
1091729090 12:2866495-2866517 CAGGGAAAGGTTGTGGCGGATGG + Exonic
1091836300 12:3588499-3588521 CAGGCAAATAGTGAGAAGTAGGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1094053714 12:26247246-26247268 TAGGGCAATATTGGGAAGGATGG + Intronic
1097362554 12:58673920-58673942 CACAGAAATATTCAGGAGGAGGG + Intronic
1098103519 12:67044180-67044202 CAGGGGGATATAGAGGAGTAGGG + Intergenic
1099200304 12:79668522-79668544 CAGGGGGATAATGGGGAGGATGG + Intronic
1099569595 12:84299832-84299854 AAGGTACATATTGAGGAGAACGG - Intergenic
1099699895 12:86070118-86070140 CATGGGAATATTTAGGAGAAGGG - Intronic
1099739752 12:86618631-86618653 CATGGAAATAGTGAGTAGAATGG + Intronic
1100653725 12:96618293-96618315 CATTGAAATATTGATGAGGAGGG + Intronic
1100787866 12:98097670-98097692 CAGGCAAAAATGGAGGGGGAAGG - Intergenic
1101167985 12:102059005-102059027 CATAGAAATATTGAGTAGAATGG + Intronic
1102384733 12:112499025-112499047 CAAGGAAGTATTGAGTAGGGAGG + Intronic
1103175698 12:118861439-118861461 CAGTGAAAGTTTGAGGAGAAGGG + Intergenic
1103302329 12:119937629-119937651 TAGGAAAGTGTTGAGGAGGAGGG + Intergenic
1104214215 12:126720213-126720235 CAGGGATATATTTAGAATGAGGG - Intergenic
1104707436 12:130958061-130958083 GAGGGGAACAGTGAGGAGGAAGG - Intronic
1106217655 13:27717654-27717676 AAGGGAAATATTGTAGAAGATGG + Intergenic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1106925270 13:34606866-34606888 AAGAGATATATTGAGGATGAGGG + Intergenic
1107115919 13:36745427-36745449 GAGGGAAATATTGGTAAGGATGG + Intergenic
1107166893 13:37292869-37292891 CAGGGAAATTTTGAGAAAAAAGG + Intergenic
1107217996 13:37944931-37944953 CAGGGAAAGAATTTGGAGGAAGG + Intergenic
1108467402 13:50730566-50730588 CAAGGAAATATTCACCAGGATGG - Intronic
1108536376 13:51384674-51384696 CAGTTAAATATGGAGGATGAGGG - Intronic
1109506932 13:63313883-63313905 CATGGACATACAGAGGAGGAAGG - Intergenic
1110834470 13:80067629-80067651 CAGTAAAATATTGAGGATAAGGG - Intergenic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111714200 13:91858691-91858713 CTGTGAAAAATAGAGGAGGAGGG - Intronic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1113094181 13:106646349-106646371 AAGGGAAATCTTGATGGGGAAGG - Intergenic
1115157720 14:30359617-30359639 CAGGGAAATATTAAGTTGGCAGG + Intergenic
1116537786 14:46057273-46057295 TAGGGAGATTTTGAGGAGAATGG + Intergenic
1116541276 14:46104901-46104923 TAGGGAGAGATAGAGGAGGAAGG + Intergenic
1116921258 14:50578291-50578313 CATGGAATTAATGAAGAGGAGGG - Intronic
1118210293 14:63759936-63759958 CAAGAAAATATTAAGGAGTAAGG + Intergenic
1120111021 14:80556512-80556534 GAGGGAAAAGTTGAGGAAGACGG + Intronic
1120907048 14:89629905-89629927 CAGCAAAATATTCAGGTGGAGGG - Intronic
1122167786 14:99842604-99842626 AAGGCAAATATTGAGGTGGTGGG + Intronic
1122488110 14:102095159-102095181 AAGGGATGTATTGAGAAGGAAGG + Intronic
1123160138 14:106270179-106270201 GAGGGAAATAATGGGGAGGCAGG - Intergenic
1124655928 15:31507288-31507310 CAGGGTTATATTGAGAAGGTTGG + Intronic
1124814265 15:32973034-32973056 CAGTGAAAGATTGAGGTGGTGGG - Intronic
1126210451 15:46095233-46095255 AAGGGAAGTGTTGAAGAGGAAGG + Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1127477571 15:59349023-59349045 CATGGACATATGGAAGAGGAAGG + Intronic
1127733473 15:61820715-61820737 GAGGGAAATGTTGAAAAGGATGG - Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130769162 15:86907051-86907073 CCGGGAAATATGGAGAAGAAAGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132405474 15:101539668-101539690 CATGGAAGTGTTGAGAAGGACGG + Intergenic
1133094222 16:3430193-3430215 CAGGGAAGTAATGACTAGGAAGG + Intronic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133768905 16:8856451-8856473 CAAAGAAATATTTAGGAAGATGG - Intronic
1135121700 16:19771760-19771782 GAGAGAAAAATTGAGGTGGAGGG + Intronic
1135155177 16:20046687-20046709 CAGGGGGAGATTGAGGAGAACGG + Intronic
1135242175 16:20817665-20817687 AAGTGAAATACTTAGGAGGATGG - Intronic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1136920503 16:34267353-34267375 CACCGGAATACTGAGGAGGAAGG - Intergenic
1137014162 16:35357459-35357481 CAGGAAAATATAGAAGGGGACGG + Intergenic
1137798462 16:51241257-51241279 AAGAGAAATAGGGAGGAGGAGGG + Intergenic
1137950757 16:52781309-52781331 CAGTGAAATATCGACGTGGAGGG - Intergenic
1138062697 16:53908558-53908580 CAGGGCAATATCAAAGAGGATGG - Intronic
1138185387 16:54972738-54972760 CCAAGAAATACTGAGGAGGAGGG - Intergenic
1138404451 16:56778409-56778431 CAGGTAAATATTGAGCAGAAAGG + Intronic
1139242576 16:65409130-65409152 CATGGAAATATTGAGTGGGTAGG - Intergenic
1139610821 16:68056683-68056705 CACTGAAATATTTAGGAGTAAGG + Intronic
1140804677 16:78522104-78522126 CAAGGGAATATGGAGGAGAAGGG + Intronic
1140852361 16:78947076-78947098 CAGGGATTTATTGAGCAGTAAGG - Intronic
1141441324 16:84031511-84031533 CAGGGGAACAGTGAGGAGGCCGG - Intronic
1142439946 16:90091152-90091174 CTGGGGAATATTGAGAAGAATGG + Intronic
1143928584 17:10396515-10396537 CAGGGATATATGGAGTAGGGAGG + Intronic
1144239506 17:13296289-13296311 CTTGGAAATATTGAAGAAGATGG + Intergenic
1145721382 17:27076100-27076122 TAGGGAAATTTGGAGTAGGAAGG - Intergenic
1147001794 17:37368622-37368644 CCTGGAAATATTGGGGCGGATGG - Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148238947 17:45987488-45987510 AAGTGAAATACTGAGAAGGATGG - Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1149561195 17:57609104-57609126 CAGGGAGATGGTGAAGAGGAGGG - Intronic
1150956667 17:69867339-69867361 CAGAGAAATATAGAGTAGAAAGG + Intergenic
1151045037 17:70909887-70909909 CAGCGAAATTGAGAGGAGGAAGG - Intergenic
1151830467 17:76546304-76546326 CAGGGAACTAATGAGGCGGTGGG + Intronic
1151962540 17:77414534-77414556 GAAGGAAATATGGAGGAGGAGGG - Intronic
1152957611 18:52402-52424 CTGGGGAATATTGAGAAGAATGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153325092 18:3810512-3810534 CTGTGAATTACTGAGGAGGAAGG + Intronic
1153927544 18:9847355-9847377 CAGGGAGCTAAGGAGGAGGAGGG - Intronic
1154371730 18:13769354-13769376 CCAAGAAAAATTGAGGAGGAGGG + Intergenic
1154490354 18:14917387-14917409 AAGGGAAAGATGGAAGAGGAAGG - Intergenic
1154497239 18:14970959-14970981 CAGGCAAATGCTGAGGAGGCTGG - Intergenic
1154947576 18:21177309-21177331 AAGGGAACTTTTGAGGATGATGG + Intergenic
1155229526 18:23758951-23758973 CATGGTAGGATTGAGGAGGATGG + Intronic
1155561047 18:27077545-27077567 TAGAGAAATATTGTGGGGGAGGG + Intronic
1158555159 18:58468965-58468987 CAGGGAAACATTGGTGAAGATGG + Intergenic
1158589327 18:58766527-58766549 TATGGAAACATTGACGAGGATGG - Intergenic
1158684960 18:59605172-59605194 CAGGGAGAAATGGAGAAGGAAGG + Intronic
1158880873 18:61778656-61778678 CAGGGAGATAAGGACGAGGAGGG + Intergenic
1159313795 18:66744175-66744197 CAAGGAAATTTTCAGGAGCATGG - Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1164362650 19:27532854-27532876 CAGGGATATATTGAAGAGCATGG + Intergenic
1164949521 19:32325241-32325263 CTGGGAAAGATTGAAGAGGGAGG - Intergenic
1165240399 19:34462205-34462227 CAGGGAGCTATTAGGGAGGAGGG + Intronic
1166219844 19:41357308-41357330 CAGGGAGACATTGAGGATCAAGG - Intronic
1166568592 19:43779846-43779868 CAGGGAAATAGTGGAGAGGTAGG - Intronic
1166629904 19:44397397-44397419 TAGGGAAGTCTTGAGGAGGTGGG - Intronic
1166637551 19:44464020-44464042 GAGGGAAGTCTTGAGGAGGTGGG + Intergenic
925551120 2:5075898-5075920 CATGTAAATACTAAGGAGGATGG + Intergenic
925840882 2:7990610-7990632 CAGAGAAATATGGAGAGGGATGG - Intergenic
926524712 2:13964425-13964447 CAAGAAAACAATGAGGAGGAGGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
929403722 2:41615477-41615499 CAGGCAGGTATGGAGGAGGATGG - Intergenic
930215716 2:48694803-48694825 GAGGGAAAGATGGAGGAGTAGGG - Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
933460150 2:82572986-82573008 GAAGGAAATAGTGAGCAGGAAGG - Intergenic
933495975 2:83051104-83051126 CAGTGAAACATTGATGATGAAGG - Intergenic
935513757 2:104008042-104008064 GATGGAAACATTGAGGAGGTAGG - Intergenic
935514931 2:104024041-104024063 CAGGGAATGATGGAGGTGGAGGG + Intergenic
935804522 2:106732708-106732730 AAGGGAAATGTTGAGGGGCAGGG + Intergenic
936370072 2:111896533-111896555 CAGGCAGATATGGAGGAGCAAGG + Intergenic
937654884 2:124363383-124363405 CAGGGAGATGTTAAGAAGGAGGG - Intronic
937694823 2:124797106-124797128 CAGAGAAATACTGATGAGGTAGG + Intronic
938543854 2:132309103-132309125 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939543995 2:143529817-143529839 CACTGGAATATTGTGGAGGAAGG - Intronic
940558444 2:155263261-155263283 CAGAGAGATAAAGAGGAGGAAGG + Intergenic
940801992 2:158143609-158143631 AAAGGAAATATTGAGAGGGAAGG + Intergenic
942744823 2:179220183-179220205 AAGGGACAGAGTGAGGAGGATGG - Intronic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944308745 2:198208073-198208095 CTCCGAAAAATTGAGGAGGAGGG - Intronic
944374191 2:199021733-199021755 CAGGGCAAAATTTTGGAGGAAGG - Intergenic
944610257 2:201396798-201396820 CTGGGAAGTATGGAGTAGGATGG + Intronic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944890925 2:204116481-204116503 CAGCGACACATTGATGAGGATGG + Intergenic
945113512 2:206388044-206388066 CAGAGGATTATTGTGGAGGAGGG + Intergenic
946982772 2:225236086-225236108 CAGGGAAAGATTGAAAAAGAAGG - Intergenic
947015734 2:225617801-225617823 CAGGGAAACATTGGAGAGGTGGG + Intronic
947446501 2:230167667-230167689 CAGGGACAGATTCAGAAGGAGGG - Intronic
1168842644 20:919566-919588 CAGGGAAACAGTGATGAGAATGG - Intergenic
1169686588 20:8280754-8280776 AAGGAAAATATAAAGGAGGATGG + Intronic
1169781518 20:9315534-9315556 CAGGCAGACATTGAGGAGTAGGG + Intronic
1171046976 20:21818117-21818139 CAAGGAAATTTAGAGGGGGATGG - Intergenic
1171795777 20:29565951-29565973 CAGGGAAAGATTGGGAAAGAGGG - Intergenic
1171872718 20:30541834-30541856 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1178097867 21:29234859-29234881 CAGGGAAATACTGGGTAGAAGGG - Intronic
1178803066 21:35815122-35815144 CAAGGAAATAGTGAACAGGACGG - Intronic
1179530139 21:42012687-42012709 CAGAGAAACACTGAGGAGGTCGG - Intergenic
1180202262 21:46231290-46231312 AAGTGAAATATTGAGTAGGCTGG + Intergenic
1180321543 22:11326012-11326034 CCTGGAAATATTGAGAAGAATGG - Intergenic
1180333512 22:11554746-11554768 CTGGGAAATATTGAGAAGAATGG + Intergenic
1182737924 22:32544350-32544372 CAGGAACATGTTGAGGAGAATGG - Intronic
1182931604 22:34179707-34179729 CAGGGAAATATTGTGGAAAAGGG + Intergenic
1182957083 22:34436583-34436605 TAGAGAAATATTGAAGAGGCAGG + Intergenic
1182986067 22:34718106-34718128 TTTGAAAATATTGAGGAGGAGGG + Intergenic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1184108971 22:42384162-42384184 CAGATAAAGATAGAGGAGGAGGG + Exonic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
1184953660 22:47864703-47864725 CAGGGGATTATTGACAAGGAGGG - Intergenic
950325874 3:12109622-12109644 CAAGGAAATTTGGAGGTGGAAGG - Intronic
951340382 3:21478880-21478902 CAGGAAAATTTGGAGGAGAAGGG + Intronic
951646713 3:24899870-24899892 CAGTGAAAAATTTAGGAGGAAGG + Intergenic
953002177 3:38945986-38946008 TAGTAAAATATTGAGGAGAATGG - Intronic
953775666 3:45814802-45814824 CAGGGAGATAGTGAGGTGGGTGG - Intergenic
953872679 3:46641154-46641176 AAGGGAAACATTGATAAGGAAGG - Intergenic
954094961 3:48318932-48318954 AAGGGGAATAGTGAGGAGCAGGG - Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
955676135 3:61450726-61450748 GTGGGAAATATTGAGGAGCAAGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
957230831 3:77511821-77511843 CAGGGAAATAGTAAGAAGCAAGG - Intronic
957590367 3:82189384-82189406 GAGGGAATGATAGAGGAGGAGGG + Intergenic
959348292 3:105227624-105227646 CAAGGAAATATTGAGATGTATGG - Intergenic
959536018 3:107485620-107485642 CAGGGAAGAATAGAGGAGGTGGG - Intergenic
959738794 3:109691922-109691944 CAAAAAAAAATTGAGGAGGAGGG - Intergenic
960312599 3:116134624-116134646 AATGCAAATATTGAGGAAGATGG - Intronic
961008366 3:123419984-123420006 CAGGGATACAGTGATGAGGATGG - Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
961175269 3:124830261-124830283 CAGGGAAAAACTGTGGAGGGTGG - Intronic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
963260414 3:143186466-143186488 CAAAGGTATATTGAGGAGGAGGG + Intergenic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
965274845 3:166668705-166668727 CAGAGAGACTTTGAGGAGGAAGG - Intergenic
966092886 3:176161099-176161121 CAGGCACATAGTCAGGAGGAAGG + Intergenic
966766105 3:183464029-183464051 AGGGGAAATGTGGAGGAGGAAGG - Intergenic
967139355 3:186541263-186541285 AAGGGAAAGATTAAGGTGGAGGG - Intronic
967503766 3:190230091-190230113 CAGGGACATATTGTAGAGTACGG + Intergenic
970326826 4:14934485-14934507 CATGAAAATAATGAGGATGAAGG - Intergenic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
971335669 4:25721681-25721703 CAGGGAAATTCACAGGAGGAAGG + Intergenic
971494814 4:27252320-27252342 CAGGGAATTAGTGAGGGGAATGG - Intergenic
972160665 4:36222931-36222953 CAGGGAATTTATGAGGAAGAAGG - Intronic
973228995 4:47820262-47820284 GAGGGAAATAATGAGGGTGAGGG + Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973820055 4:54655141-54655163 CAGGAAAGTATTGAGGATAAAGG + Intergenic
973853697 4:54987738-54987760 CAGGGAAATATTGAAAACCAGGG + Intergenic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974962866 4:68725159-68725181 CAGAGAAATAGAGAAGAGGAGGG - Intergenic
975431000 4:74290749-74290771 CAGAAAAGTAATGAGGAGGATGG - Intronic
975621402 4:76300229-76300251 GAGGGAAATATGAGGGAGGAAGG - Intronic
975747001 4:77484630-77484652 CTTTGAAATATAGAGGAGGAAGG + Intergenic
976056542 4:81075577-81075599 TAGAGAAATATTGAGAAGGTAGG + Intergenic
976641495 4:87343441-87343463 TAGAGAAATACTGAGGGGGAAGG + Intronic
976792015 4:88889034-88889056 CAGGGGAATAATGACAAGGAGGG + Intronic
976870872 4:89791968-89791990 CAGGGAGAAATTGAACAGGATGG - Intronic
977243224 4:94599312-94599334 TATAGAAATATTGAGGTGGAGGG + Intronic
977672842 4:99716009-99716031 CAGGGAAATTTTGGGCAGAAGGG + Intergenic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978228253 4:106364973-106364995 TAGGGAAATATTGAGACGTATGG + Intergenic
978602028 4:110438775-110438797 AAGGGAAATATTGATGAGAAAGG - Intronic
979407238 4:120328199-120328221 CAGGGATAAAGTGAGGGGGAAGG + Intergenic
980871403 4:138615434-138615456 CAGGGAAATACTGGGTAGAAGGG + Intergenic
981362718 4:143866221-143866243 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981373450 4:143987022-143987044 CAAGGAAATATTGGGGAGAAGGG + Intergenic
981382552 4:144090276-144090298 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981815915 4:148830201-148830223 CAGGGAAATACTGGGTAGAAGGG - Intergenic
982341705 4:154306901-154306923 CAGAGAAATATTGAGTAGAGTGG - Intronic
983129282 4:163995221-163995243 CAGGGAAATATTCAGGTGTATGG + Intronic
984070589 4:175107474-175107496 CAGGTAAATATGTAGGAGAAAGG + Intergenic
984930245 4:184840845-184840867 CACAGAAGTATTGAGGAGGGAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986796215 5:11214877-11214899 AAGGGGAAGATTGAGGATGAAGG - Intronic
986797928 5:11230698-11230720 CAAGGAAAAATTAAAGAGGATGG - Intronic
986902791 5:12457749-12457771 CAGTGAAATAATGAGAAGGCAGG - Intergenic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987510721 5:18834449-18834471 CATGGAAATATGGATGAGCATGG - Intergenic
987601629 5:20079248-20079270 CATGGAAGTATTGAGTAGAATGG - Intronic
988204746 5:28119549-28119571 TTCTGAAATATTGAGGAGGAGGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988339374 5:29950088-29950110 CAGGGAATTATGGAGGTGGGGGG - Intergenic
990052007 5:51514071-51514093 CAGGAAAATATTTAGAAGTAAGG + Intergenic
990261288 5:54025727-54025749 CAGGGATAAATTGACCAGGAAGG + Intronic
990443528 5:55870549-55870571 AAGGGAAAGATGGAGGAAGAGGG - Intronic
990856590 5:60274152-60274174 CAGGCAAATATTGATGATGGGGG + Intronic
991027194 5:62042611-62042633 AAGGGAAAAATTGAGCAAGAAGG + Intergenic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
991293818 5:65060296-65060318 CTGAGAAATATTTAGGAGGTAGG + Intergenic
992028088 5:72691264-72691286 CTGAGAAACATTGAGTAGGAAGG + Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
993765734 5:91855364-91855386 CAAGGCAATATTGAAGAAGATGG + Intergenic
993808707 5:92445792-92445814 AAGGGAAAAACAGAGGAGGAGGG - Intergenic
994520790 5:100831991-100832013 CTAGGAAATATTTAGAAGGAAGG + Intronic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995331254 5:110949480-110949502 CACCGGAATACTGAGGAGGAAGG - Intergenic
995505457 5:112855632-112855654 GAGAGAAAAATTAAGGAGGAGGG + Intronic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998193377 5:140045040-140045062 CATGGCAATACAGAGGAGGAAGG - Intergenic
998581117 5:143377128-143377150 CAGTGGAATACTGAGGAGTAAGG - Intronic
998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG + Intergenic
998820293 5:146051976-146051998 CTGGGAAGTATTGAGGAGTGTGG + Intronic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1001448845 5:171808409-171808431 CGGGGAAAGAGAGAGGAGGAGGG + Intergenic
1002058311 5:176610914-176610936 CAGGGAAATGTGGAGGGGGTGGG - Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002307443 5:178292181-178292203 CAGGAACAGATCGAGGAGGAGGG - Intronic
1003283050 6:4710776-4710798 CTGGGAAGCTTTGAGGAGGAGGG - Intronic
1003373473 6:5551381-5551403 CAAGGAAAAAGTGAGGAGCATGG - Intronic
1003607239 6:7573721-7573743 CAGGGAAACAGAGAGTAGGATGG + Intronic
1003682274 6:8267869-8267891 CAGGGGAATATTGAGAGTGATGG - Intergenic
1004192620 6:13477412-13477434 CAGGAAAAGATTGAGGGAGAAGG - Intronic
1005087138 6:22018735-22018757 CAGTGAGCCATTGAGGAGGAAGG - Intergenic
1005390944 6:25332578-25332600 GAGGGACATGTTGAGGAAGAAGG + Intronic
1005641647 6:27801998-27802020 CATGGAAACATTGCAGAGGAAGG + Intergenic
1005834570 6:29698278-29698300 AAGGGAAATTTTTAGGATGAAGG - Intergenic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008790400 6:55224812-55224834 CATGGAAATATAGAGTAGAATGG + Intronic
1008902933 6:56643662-56643684 TAGGAAAATATTTAGGAGGCTGG - Intronic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1010919951 6:81668947-81668969 CAGGGACATTTTCTGGAGGAAGG - Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1014327047 6:120010813-120010835 CAGCGTGATATTGAGTAGGAGGG + Intergenic
1014540017 6:122663913-122663935 CAGAGAAATATGGAGGTGGGTGG + Intronic
1014547922 6:122754375-122754397 CATTGAAATAGGGAGGAGGAAGG - Intergenic
1014688808 6:124535872-124535894 GAGGGAAGCAGTGAGGAGGAAGG - Intronic
1014870411 6:126588370-126588392 CCCAAAAATATTGAGGAGGAGGG - Intergenic
1015118945 6:129680469-129680491 GAGGTTATTATTGAGGAGGAAGG - Intronic
1015206776 6:130649541-130649563 GGGGGAAATACTGAGGAGTAGGG - Intergenic
1015391596 6:132688539-132688561 TAGGAAAAGATTGAGGAGGCAGG + Intronic
1015673305 6:135716681-135716703 CAGAGAAATATACAGGAGAATGG - Intergenic
1015723711 6:136276221-136276243 CACCGGAATACTGAGGAGGAAGG - Exonic
1016520213 6:144938497-144938519 CTGGGTAGTATTGAGGAGAAAGG - Intergenic
1017921630 6:158877988-158878010 AAGGGAAATAATGAGAAAGATGG - Intronic
1018219373 6:161562982-161563004 CTGGAAAATACTGAGCAGGAAGG - Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018389342 6:163330554-163330576 AAGGAAAATAATGAGGAAGATGG - Intergenic
1019554825 7:1624026-1624048 CAGGGACTGAGTGAGGAGGAGGG - Intergenic
1019560107 7:1651629-1651651 CAGGGAACTATTCAGGGGGAGGG + Intergenic
1019825308 7:3279523-3279545 GAGGGAAAGATGGGGGAGGAGGG + Intergenic
1020496603 7:8860934-8860956 CTGTGAAATATTGACCAGGATGG - Intergenic
1021596109 7:22318703-22318725 CTGGGAAGCATTGAGGAAGATGG - Intronic
1021913120 7:25406031-25406053 CAGGGAAAGATTTATGAGCAAGG - Intergenic
1022343492 7:29490259-29490281 CTGGGAAAGATTGAGCAGGTGGG - Intronic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1024939501 7:54747169-54747191 GAGGGGAAAATTGATGAGGAGGG - Intergenic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1028521640 7:91738194-91738216 CTGACAAAGATTGAGGAGGAGGG - Intronic
1029222331 7:99000478-99000500 GAGGGAAACACTGTGGAGGAGGG - Intronic
1029526960 7:101100620-101100642 CACGGAAAGAGTGAAGAGGAGGG - Intergenic
1029955414 7:104633875-104633897 CAAGGAAATAGGGTGGAGGATGG - Intronic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1030598217 7:111563757-111563779 CAGGGAATTATGGAGGGGTAAGG - Intergenic
1030891137 7:115001025-115001047 CAGTCAAGTATAGAGGAGGAAGG - Intronic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033012395 7:137636376-137636398 CTGGGAAACATAGAAGAGGAAGG - Intronic
1033357728 7:140614018-140614040 AAGGGAAACAGTGAGCAGGAGGG - Intronic
1033533642 7:142291304-142291326 CTGGGTAATATTAAGGAAGAAGG - Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1035972852 8:4270792-4270814 CAGGGAACTTTCTAGGAGGAAGG - Intronic
1036177075 8:6549444-6549466 GAGGGGGATATTGACGAGGAGGG + Intronic
1037647820 8:20809859-20809881 GAGGGAGATAATGGGGAGGAAGG - Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038014370 8:23501189-23501211 CATGGAAATATTGAGGAAAAGGG + Intergenic
1038247351 8:25871164-25871186 CAGGGAAGTAGGGAGGGGGAGGG - Intronic
1038253554 8:25928803-25928825 CAGGGAAATGGAGAGGAGAAAGG + Intronic
1038607469 8:29022863-29022885 CAGGGAAAAAATGGGGGGGAGGG + Intronic
1038655326 8:29445488-29445510 CAGGTAAATGTAGAGGAGAAAGG - Intergenic
1039248552 8:35635967-35635989 GAGGAAACTATTGAGGAAGAAGG + Intronic
1039911007 8:41826883-41826905 CAGGGAAAGATTTAGATGGATGG - Intronic
1041110089 8:54475662-54475684 CAGGAAAATACTGAGGAAAAAGG + Intergenic
1043084860 8:75816700-75816722 AAGGAAAATATTGAGAAGTATGG - Intergenic
1044634000 8:94304184-94304206 CTAGGAAAGATTAAGGAGGAGGG + Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045560499 8:103257429-103257451 CAGGTAAGCATGGAGGAGGAGGG - Intergenic
1045799507 8:106086237-106086259 CAGGGAAATGTTGATGCAGATGG - Intergenic
1045887357 8:107114336-107114358 CAGGGCTATACTGAGGATGATGG + Intergenic
1047024988 8:120814486-120814508 GAGGGAGACACTGAGGAGGAAGG + Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1048859947 8:138716850-138716872 CAGGGAGAAATTGGGGAGCAGGG - Exonic
1050410282 9:5356822-5356844 AAGGTAAACATTGAAGAGGAAGG - Intergenic
1051053639 9:12958194-12958216 CTGTGCCATATTGAGGAGGAGGG - Intergenic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052778842 9:32759968-32759990 CAGGAAGTTATGGAGGAGGAGGG + Intergenic
1053729223 9:41035556-41035578 CAGAGATTTATTGAGAAGGAGGG + Intergenic
1054699290 9:68396510-68396532 CAGAGATTTATTGAGAAGGAGGG - Intronic
1054720601 9:68599935-68599957 GAGGGAACTAGAGAGGAGGATGG - Intergenic
1054735636 9:68747066-68747088 CAGGGAAAGAATGAGAGGGAAGG - Intronic
1056765581 9:89442793-89442815 CTGGGAAATGGTGAGAAGGATGG - Intronic
1058616847 9:106838787-106838809 GATGGAAATATTTAGGAAGAAGG + Intergenic
1059258966 9:112957570-112957592 CAGGGAATTACTGCAGAGGAAGG + Intergenic
1059693007 9:116703916-116703938 CAGGGCAACAGTGAGGAAGAAGG + Intronic
1059837019 9:118166690-118166712 GAGGGGAATAATCAGGAGGAAGG - Intergenic
1060624703 9:125101105-125101127 CAGGCACAGATTGATGAGGAGGG + Intronic
1062740533 9:138172168-138172190 CTGGGGAATATTGAGAAGAATGG + Intergenic
1185660825 X:1727657-1727679 CAGGGAAATTCCGACGAGGAGGG - Intergenic
1185921200 X:4095118-4095140 CAGGGAGCTATTCAGGAGAAAGG + Intergenic
1186570559 X:10710902-10710924 CAGAGCAAAATTGAGGAGCATGG - Intronic
1187390767 X:18885254-18885276 AAGAGAAATATTGAAGGGGAAGG - Intergenic
1187553652 X:20330899-20330921 CAAGGAGACATTGAGGAAGAAGG - Intergenic
1188922597 X:35995848-35995870 AAGGAAAATATAGAGGAGAAAGG + Intergenic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1189646895 X:43142925-43142947 GAGTGAAATTTTGAGGAGGGTGG - Intergenic
1190125855 X:47704859-47704881 ATGGGAAACATTGAGGTGGATGG + Intergenic
1191254815 X:58275129-58275151 CAGGGAAAGGTTGAAGAGGCTGG - Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191669081 X:63732350-63732372 ATGGGAAAAATTGAGAAGGAGGG - Intronic
1192563120 X:72140450-72140472 CAGGGAAGTGTAGAGGACGAGGG + Exonic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1194981812 X:100449380-100449402 CAGGAAAATATGAAGAAGGAAGG - Intergenic
1195657586 X:107347015-107347037 CAGGGAAAGATTTGGGAGGGAGG + Intergenic
1195977506 X:110543532-110543554 CAAGGAAATAATAAGGAGGAAGG + Intergenic
1197140772 X:123115201-123115223 CAGGGCAAGATTGAGGGAGAGGG - Intergenic
1201068541 Y:10123239-10123261 CTGGGGAATATTGAGAAGAATGG + Intergenic
1202036063 Y:20637257-20637279 CAGTGATATGTTGAAGAGGACGG + Intergenic