ID: 1127798715

View in Genome Browser
Species Human (GRCh38)
Location 15:62459455-62459477
Sequence ACTAGGACATTCAGGGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127798715_1127798720 12 Left 1127798715 15:62459455-62459477 CCTCAAGCCCTGAATGTCCTAGT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1127798720 15:62459490-62459512 TATGATAGAGGAAAATTTACTGG 0: 1
1: 0
2: 0
3: 23
4: 264
1127798715_1127798721 24 Left 1127798715 15:62459455-62459477 CCTCAAGCCCTGAATGTCCTAGT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1127798721 15:62459502-62459524 AAATTTACTGGAGTTTGAATAGG 0: 1
1: 0
2: 1
3: 35
4: 300
1127798715_1127798719 0 Left 1127798715 15:62459455-62459477 CCTCAAGCCCTGAATGTCCTAGT 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1127798719 15:62459478-62459500 AAGTAAAAAATTTATGATAGAGG 0: 1
1: 0
2: 1
3: 43
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127798715 Original CRISPR ACTAGGACATTCAGGGCTTG AGG (reversed) Intronic
900495143 1:2972798-2972820 ACTGTGCCAGTCAGGGCTTGGGG - Intergenic
904463863 1:30696685-30696707 ACTAGGGCCTTGAGGGCCTGAGG + Intergenic
904464358 1:30699050-30699072 ACTAGGGCCTTGAGGGCCTGAGG + Intergenic
905978833 1:42204231-42204253 ACTAAGACAACCAGGGCTTCAGG - Intronic
906558570 1:46735792-46735814 ACTTTGACATTCTGGGCTAGAGG - Intergenic
906934589 1:50201166-50201188 AATGGGAAATTCAGGACTTGTGG - Exonic
909797499 1:79760337-79760359 ACAAAGACATTCAGAACTTGAGG + Intergenic
912797828 1:112703577-112703599 ACTAGGTCATTCAGTGACTGGGG + Intronic
913224593 1:116687709-116687731 TCTAGGATATGCAGGGCTGGAGG + Intergenic
917094355 1:171385269-171385291 TCTAGGATATTCAAGGCATGTGG - Intergenic
920984831 1:210877088-210877110 ACTATGAGATTCAGGCTTTGTGG - Intronic
923763131 1:236865975-236865997 GCAAGCACATTCAGGGCTTTTGG + Intronic
924183951 1:241467054-241467076 TCTAGGTCACGCAGGGCTTGTGG + Intergenic
924267657 1:242299621-242299643 CCCAGGACATTCATGACTTGGGG - Intronic
924772531 1:247089702-247089724 AGTAGGACATTCAGACCCTGGGG + Intergenic
1066389490 10:34967318-34967340 ACTATGACCTTCAATGCTTGAGG - Intergenic
1066717230 10:38299118-38299140 CCCAGGACATTCATGACTTGGGG + Intergenic
1067755097 10:48999277-48999299 TCAGGGAGATTCAGGGCTTGGGG + Intergenic
1068943055 10:62700023-62700045 ACTTGGACACTTAGGGGTTGTGG - Intergenic
1069992578 10:72324338-72324360 ACCAGAACATGCTGGGCTTGGGG - Intergenic
1071604865 10:86978809-86978831 ACTAGGAAATAAAGGGATTGGGG + Intronic
1075083564 10:119399455-119399477 GCAAGGACAATCTGGGCTTGGGG - Intronic
1077370474 11:2179495-2179517 GCTTGGACATACAGGGCCTGAGG + Intergenic
1079143301 11:17828775-17828797 ACTAGGACTTTCTGGGTTGGAGG - Intronic
1083278232 11:61609408-61609430 GCTGGGCCATTTAGGGCTTGCGG - Intergenic
1085528433 11:77177360-77177382 ACCAGGACAGACAGGGGTTGTGG - Intronic
1086561787 11:88176778-88176800 AATTGGGCATTCAGGGCTAGGGG + Intergenic
1090476573 11:127027261-127027283 ACTTCCACATTCAGAGCTTGAGG + Intergenic
1096548040 12:52354747-52354769 ACCAAGACAGTCAGGGCTTTGGG - Intergenic
1098827724 12:75318670-75318692 TCTAGGAAAGTCAGGGCTTTGGG - Intronic
1100586918 12:95989035-95989057 AATAGTACATTCAGTGCTTGAGG + Intronic
1102247068 12:111362542-111362564 ACCAGGCCACTCAGGGCCTGGGG + Exonic
1103421866 12:120792153-120792175 ACTAGGAAATGCAGGGGTTAGGG + Intronic
1104715983 12:131016539-131016561 ACTTGGAGCTTCTGGGCTTGAGG + Intronic
1117211237 14:53502576-53502598 ACTAGGGCATTCAGTGAATGAGG + Intergenic
1118023221 14:61740855-61740877 ACTTGCGCTTTCAGGGCTTGCGG - Exonic
1120517311 14:85486090-85486112 ATTAGGACATAAAAGGCTTGAGG + Intergenic
1123982892 15:25620085-25620107 ACTCAGACAATCAGAGCTTGGGG - Intergenic
1125261851 15:37834982-37835004 TCCAGGACATTCAGGCCTTGGGG - Intergenic
1127798715 15:62459455-62459477 ACTAGGACATTCAGGGCTTGAGG - Intronic
1130526733 15:84713581-84713603 TCTAGGACATTCAGGGTTAGTGG - Intronic
1130879746 15:88044896-88044918 AGAAGTACCTTCAGGGCTTGTGG - Intronic
1131840391 15:96430511-96430533 CCTAGGAAAATCAGGGCTAGAGG - Intergenic
1133639608 16:7704171-7704193 GCTTGGAGATTCAGGACTTGGGG - Intronic
1141515537 16:84542338-84542360 TCTAGGACATTCTAGGCTTTTGG - Intronic
1141747571 16:85936080-85936102 ACAAGGAGATTCAGGGGATGCGG - Intergenic
1143615368 17:8046331-8046353 ACTAGGAAAACCAGGGCCTGTGG - Intronic
1145722088 17:27082929-27082951 AGTAGGACACAAAGGGCTTGTGG + Intergenic
1148904053 17:50900353-50900375 CTCAGGACATTCAGGGCATGTGG + Intergenic
1151306933 17:73268557-73268579 AATAGGACATTTTGGGCTTAGGG + Intergenic
1153229022 18:2919608-2919630 ACTAAGAAATTAAGGGCTCGTGG + Exonic
1157591504 18:48838922-48838944 ACTAGGACACTTAGAGATTGAGG - Intronic
1159756797 18:72375838-72375860 ACAAGGCCATGCAGGGCCTGTGG + Intergenic
1160949527 19:1658746-1658768 AGGAGGAGACTCAGGGCTTGGGG + Intergenic
1161713765 19:5864185-5864207 TCTGGAACATTCTGGGCTTGGGG - Intergenic
1165978026 19:39694161-39694183 AGGAGGACACTCAGGGATTGGGG + Intergenic
925024550 2:597450-597472 ATCAGAACATTCAGGGCTTTGGG + Intergenic
925702596 2:6653881-6653903 ACAAGGACATGAAGGGCTGGGGG - Intergenic
926387641 2:12352988-12353010 CCTAGGACATCCAGGGCTATGGG + Intergenic
926732629 2:16048521-16048543 CCTAGGGCCTTAAGGGCTTGGGG + Intergenic
927297542 2:21471608-21471630 ACAAGGAAATTCAGGGCCTGGGG + Intergenic
928810577 2:35219509-35219531 AGAAGGACATGCAGGGCTTTGGG - Intergenic
931003436 2:57818195-57818217 ACATGGACCTTCAGGGCTTATGG - Intergenic
934041240 2:88129248-88129270 ACTAGGCCATCCAGGACCTGTGG - Intergenic
934053511 2:88231403-88231425 ACTAGGAGCCTCAAGGCTTGAGG - Intergenic
935890578 2:107673419-107673441 ACCAGGACATTCAAGAATTGTGG - Intergenic
937288373 2:120767214-120767236 ACTAGGCCAGTCAGAGCCTGGGG + Intronic
937856364 2:126674513-126674535 ACCACCACATTCAGGGCTCGAGG - Intronic
940165192 2:150763216-150763238 ATTAAGACACTCATGGCTTGGGG + Intergenic
943143690 2:184015668-184015690 ACTAAGACTTTCAGTGGTTGTGG - Intergenic
943414375 2:187581828-187581850 ACTAGGACACTCAGCACTTTTGG - Intergenic
944957910 2:204833880-204833902 GCTGGGACACTCCGGGCTTGTGG - Intronic
945213837 2:207412528-207412550 AGGAGGACAGTGAGGGCTTGGGG + Intergenic
947876590 2:233471597-233471619 AGTAGGACACTGAGGACTTGGGG - Exonic
1172187378 20:33039559-33039581 TCTTGGATATTCAGGGCTGGAGG + Intronic
1175276626 20:57775119-57775141 ACTGGGACCAGCAGGGCTTGGGG - Intergenic
1177060211 21:16363386-16363408 AAGAGTACATTCAGGGCTTTTGG - Intergenic
1183461698 22:37954852-37954874 ATTTGGACATTGAGTGCTTGGGG + Intronic
1184767092 22:46577555-46577577 ACGAGGACATCCCGGGGTTGCGG + Intronic
949448618 3:4162383-4162405 ACTAGGACTTGCAGTCCTTGTGG + Intronic
950063556 3:10092642-10092664 ACAAGGACATTCTAGGCTGGGGG - Intronic
950136277 3:10583440-10583462 GCTAGGACAAACAGGGCTTAGGG - Intronic
950687152 3:14626865-14626887 ACTAGGACTGGCAGGGCGTGGGG - Intergenic
952188892 3:31001035-31001057 GGTAGGACAATCAGGGCTCGAGG - Intergenic
954451453 3:50573877-50573899 AGTAGGAAACTCAGGGCTGGGGG + Intronic
955155494 3:56413096-56413118 ACTAGGACATGCTGTGCTGGTGG + Intronic
958757927 3:98272213-98272235 CCTAGGATCTTCAGTGCTTGTGG + Intergenic
959615020 3:108337587-108337609 ACTAGGACATCCAGTGATTAAGG - Intronic
959652857 3:108768754-108768776 ACAGGAACATGCAGGGCTTGGGG + Intergenic
960313469 3:116146295-116146317 ACAAGGACATTCAAAGCCTGGGG - Intronic
963266822 3:143248129-143248151 AGTAGGACAGTCAGGGCTGGTGG - Intergenic
964261996 3:154849654-154849676 ATTAAGACAGACAGGGCTTGCGG + Intergenic
970910147 4:21265330-21265352 ATTAGGACATTAAGGGCCTTGGG + Intronic
975915402 4:79319225-79319247 AGCAAGACATTAAGGGCTTGGGG - Intronic
977863731 4:101998449-101998471 ACAAGGATATTCAGGACTTGAGG - Intronic
981532290 4:145764283-145764305 ACTAGGACATACATTTCTTGAGG + Intronic
983100939 4:163624710-163624732 ACTAGGACACTCAGGTAATGGGG - Intronic
987853173 5:23383110-23383132 ACTGGGGCCTGCAGGGCTTGAGG + Intergenic
991297107 5:65093169-65093191 ACTAGGACTTACAGTCCTTGTGG - Intergenic
991395381 5:66199074-66199096 ACTAGGACATACAGTCCTTGTGG + Intergenic
991446600 5:66707032-66707054 TCTTGGACATTCAGGGTGTGGGG + Intronic
992304476 5:75422113-75422135 ACCAGAATATTCAGGGGTTGAGG - Intronic
992751545 5:79867252-79867274 AATAGGACCCTCAGGGATTGCGG + Intergenic
998394096 5:141807035-141807057 ACTTGAACATGCAGGGCTTTAGG - Intergenic
1000261271 5:159590976-159590998 ACCAGCACATTCAGTGCTTGGGG + Intergenic
1002066388 5:176654151-176654173 ACCAGCACATGCAGGGCATGTGG + Intronic
1006109703 6:31737082-31737104 ACTAGGACTTGCAGTCCTTGTGG + Exonic
1006173850 6:32110117-32110139 ACTGGGACATACAAGCCTTGGGG + Intronic
1007431253 6:41778808-41778830 ATTAGGCCTTTCAGAGCTTGGGG - Intronic
1012224411 6:96688226-96688248 ACTAGGACTTGAAGTGCTTGTGG - Intergenic
1015591822 6:134829685-134829707 ACTGGGACATTCAGGGCATTGGG + Intergenic
1016921664 6:149300971-149300993 GCTATGCCATTCAGAGCTTGGGG + Intronic
1023663029 7:42490099-42490121 AGGAAGATATTCAGGGCTTGGGG - Intergenic
1026069278 7:67103523-67103545 ACTAATACTTTCAGGACTTGAGG + Intronic
1033563290 7:142554641-142554663 ACTCACATATTCAGGGCTTGGGG - Intergenic
1035334929 7:158121710-158121732 ACAAACACATTCTGGGCTTGTGG - Intronic
1036672321 8:10799694-10799716 ACTCAGACATGCAGGGATTGTGG - Intronic
1037797609 8:22009923-22009945 ACTGGGACAGGCAGGGGTTGGGG - Intergenic
1038091991 8:24264688-24264710 ACAGAGACATTCAGGACTTGAGG + Intergenic
1039740075 8:40374815-40374837 TCTAGGTCAATCAGGGCTTCTGG - Intergenic
1042120185 8:65478872-65478894 ACTGGGACATTGAGGATTTGTGG + Intergenic
1049200623 8:141338617-141338639 CCTAGGACACTCAGGGCCTTGGG - Intergenic
1049742263 8:144246879-144246901 ACCAGGACAGTCAGGGTGTGAGG + Intronic
1049873263 8:144998541-144998563 ACTAGGACATTTTGTGCTTTTGG + Intergenic
1050566914 9:6894630-6894652 AATAGGACATTCCAGCCTTGGGG + Intronic
1055387198 9:75775390-75775412 ACTAGGACTTGCAGTCCTTGTGG - Intergenic
1056714918 9:89020956-89020978 ATGAGGACACTCAGGGCTTGGGG + Intronic
1059283801 9:113155991-113156013 ACTAGAACATGCAAGGCCTGTGG + Intronic
1060081666 9:120653218-120653240 ACTAAGAAATTCAGTGCTTAGGG + Intronic
1060408407 9:123383982-123384004 CCAAGCACATTGAGGGCTTGAGG + Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1189284409 X:39841146-39841168 ATTGGGACTTTCAGGGCTTCAGG - Intergenic
1193871981 X:86809710-86809732 ACTAGGAAATTTATTGCTTGTGG + Intronic
1199090040 X:143680855-143680877 CCTTGGACCTTTAGGGCTTGGGG + Intergenic