ID: 1127805121

View in Genome Browser
Species Human (GRCh38)
Location 15:62512089-62512111
Sequence CTGCTGTCCTGGGTCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127805114_1127805121 21 Left 1127805114 15:62512045-62512067 CCAGCACTTACTTCTTCAGTCAC 0: 1
1: 1
2: 1
3: 18
4: 208
Right 1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 347
1127805113_1127805121 27 Left 1127805113 15:62512039-62512061 CCTCTTCCAGCACTTACTTCTTC 0: 1
1: 1
2: 2
3: 42
4: 396
Right 1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG 0: 1
1: 0
2: 2
3: 36
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127805121 Original CRISPR CTGCTGTCCTGGGTCACAGC TGG Intronic
900288676 1:1914588-1914610 CAGCTGGCCTGGGTTTCAGCGGG + Intergenic
900289610 1:1918381-1918403 CTGCTGTGTGGTGTCACAGCTGG - Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900673161 1:3868408-3868430 CTGCTGACCTTGGTCACAGTTGG - Intronic
901044061 1:6385170-6385192 CAGCTGTGCTGGCTCACAGCTGG - Intronic
901319294 1:8329966-8329988 CTGCTGCCGGGGGTCACACCAGG + Intronic
901436500 1:9250179-9250201 CTGCTGTCCCGGGTGAGGGCGGG + Intronic
901632187 1:10653369-10653391 CTGCTCACCTGGGTCAAAGGTGG + Exonic
901764166 1:11489407-11489429 CAGCTTTGCTGGGACACAGCAGG - Intronic
901783250 1:11608484-11608506 CAGCTGTCCTGAGCCACAGGGGG - Intergenic
902146000 1:14399623-14399645 TCTCTGTCCTGGGTCACAGCTGG + Intergenic
903466581 1:23556183-23556205 CTTCTGTCCTGGGAGGCAGCAGG + Intergenic
903583980 1:24394181-24394203 CTGTTTTCATGAGTCACAGCGGG + Intronic
904343989 1:29856282-29856304 CTGCAGCCCTGGCTCAGAGCTGG - Intergenic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
905215178 1:36401649-36401671 CTCCTGTCCTGGGTTCCACCTGG + Intergenic
906778735 1:48553221-48553243 CTGCTGAGCTGGGGCCCAGCTGG - Intronic
906807877 1:48796936-48796958 CTGCTTTCCTGTGTCAGAGTAGG - Intronic
907247384 1:53116753-53116775 CTGCTGTCCTGTGTGACCTCAGG - Intronic
907459499 1:54597038-54597060 CTGCTGTCTTGTCTCAGAGCTGG + Intronic
908785877 1:67734119-67734141 TAGCTGTCCTGTGTCCCAGCGGG + Intronic
910599387 1:89014520-89014542 GTGCTGTTCTGGGTCACAAAAGG + Intronic
910603701 1:89059290-89059312 GTGCTGTTCTGGGTCACAAAAGG + Intronic
911065763 1:93786450-93786472 CTGCTCTCCATGGTCTCAGCTGG - Intronic
914337654 1:146730278-146730300 GTGCTGTGCTGGGTCAGAGTTGG + Intergenic
915626361 1:157116299-157116321 CTCCTGTCCTCTGTCACTGCTGG + Intergenic
916210936 1:162359432-162359454 TTGCTGTCCAGGACCACAGCAGG + Intronic
916213114 1:162374294-162374316 CTGCTGTGCTGGGTGCCACCTGG + Exonic
918435861 1:184512144-184512166 CTGCCCTCCTTGCTCACAGCAGG + Intronic
920828618 1:209445845-209445867 CTGCTGCCAAGGGACACAGCAGG - Intergenic
922517034 1:226215260-226215282 CTGCTGTGCTGGCTCTCTGCAGG + Intergenic
924497610 1:244605301-244605323 CTGCTGTCATGGGTGTTAGCAGG - Intronic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1063441386 10:6075921-6075943 GTGCTGTCCTGGTGCACAGGTGG - Intergenic
1063796356 10:9517629-9517651 GGGTTGTTCTGGGTCACAGCTGG + Intergenic
1065047026 10:21754071-21754093 CTGCCACCCCGGGTCACAGCAGG - Intergenic
1065088701 10:22207595-22207617 CTGCTGGCCTGGAGCTCAGCTGG + Intergenic
1067449510 10:46373249-46373271 CTGCTGCCCTTGGTCCCATCGGG + Intronic
1067587865 10:47487514-47487536 CTGCTGCCCTTGGTCCCATCGGG - Intronic
1067634986 10:47995621-47995643 CTGCTGCCCTTGGTCCCATCGGG - Intergenic
1068739251 10:60450263-60450285 CAGCTAGCCTGGGTGACAGCGGG + Intronic
1068928462 10:62564354-62564376 CAGCTGTCCAGAGCCACAGCTGG + Intronic
1069790068 10:71013807-71013829 CTGCAGTCCTGGCTCCCAGCTGG - Intergenic
1069804309 10:71108415-71108437 CAGCATTCCTGGGTGACAGCTGG + Intergenic
1070240520 10:74675632-74675654 CTGCTGTGCTTTGTCACAGCAGG + Intronic
1070625300 10:78046865-78046887 CTGCTGTCCAGGACCACACCTGG - Intronic
1070897370 10:79996263-79996285 CTGTTGTCCTGGGAAACACCTGG - Intergenic
1071284956 10:84136041-84136063 CTCCTCTCCTGGGCCACAACTGG + Intergenic
1071610130 10:87024409-87024431 CTGCTGCCCTTGGTCCCATCGGG + Intronic
1072735222 10:97874547-97874569 CAGGTGTCCTGGGTGGCAGCAGG + Intronic
1074666422 10:115731236-115731258 CTGCTTTCCTGCCCCACAGCAGG + Intronic
1074813284 10:117126152-117126174 CCACTGCCTTGGGTCACAGCTGG + Intronic
1074942891 10:118252134-118252156 CTCCAGCCCTGGGTCTCAGCAGG + Intergenic
1075396734 10:122133112-122133134 CTGATCTCCTGGGACAGAGCTGG + Intronic
1075472376 10:122701308-122701330 CTGATGTCCAGGCTCACAGATGG - Intergenic
1076252331 10:128994506-128994528 CTCCAGTCCTGGGGCCCAGCAGG + Intergenic
1076700615 10:132270872-132270894 CTTCTGCCCTGGGCCACAGGTGG - Intronic
1076854700 10:133110149-133110171 CTCCTGTCCTGGGAGACGGCAGG + Intronic
1076888516 10:133273277-133273299 CTGCCGTCCGGGGTCCCAGGAGG + Exonic
1077332397 11:1989336-1989358 CTGGGGTTCTGGGCCACAGCCGG + Intergenic
1077364932 11:2157825-2157847 CGGCTGCCCTGGGCCAGAGCTGG - Intronic
1079396204 11:20065989-20066011 CATTTGTCCAGGGTCACAGCTGG - Intronic
1083590019 11:63888433-63888455 GTGCTTTGCTGGGTAACAGCTGG - Intronic
1083853522 11:65380883-65380905 CTGCTGTCCTGAGTCCCCTCTGG - Intronic
1084396659 11:68915542-68915564 CTGCTGTCTTGGCTCACTGCAGG + Intronic
1084550735 11:69840349-69840371 CAGCTGTCCTGCTTCACTGCTGG + Intergenic
1085971003 11:81590467-81590489 CCTCTGTCCTGGGTCACACAAGG + Intergenic
1086226999 11:84524176-84524198 AAGCTGTCCTGAGTCACAGGTGG + Intronic
1089080443 11:115772191-115772213 CTGCTGACCTTGGTGACAGTAGG + Intergenic
1089183988 11:116602562-116602584 CTGTTCTCCTGGGACCCAGCTGG + Intergenic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090402236 11:126456346-126456368 CACCTGTACTGGGTGACAGCTGG + Exonic
1090478896 11:127050230-127050252 CTGCTGTCCTGTCTCCCACCAGG + Intergenic
1090657120 11:128854558-128854580 CTGCTTTCTTGGGTGACAACAGG + Intronic
1091104226 11:132903273-132903295 CTCCTGTCCTTGGTCACATATGG - Intronic
1091225715 11:133955816-133955838 CCGCTTTCCTGGGTCTGAGCTGG - Intronic
1091316437 11:134617350-134617372 CTGCTGCCCTGTGTCACCTCAGG + Intergenic
1091360907 11:134977914-134977936 CAGATGGCCTGGGGCACAGCAGG - Intergenic
1202815378 11_KI270721v1_random:44512-44534 CTGGGGTTCTGGGCCACAGCCGG + Intergenic
1091530657 12:1352034-1352056 ATGCTGTGCTGGGTTAAAGCTGG - Intronic
1092350606 12:7752635-7752657 CTGCACTCCTGGGTGACAGAGGG + Intergenic
1092525377 12:9306506-9306528 CTGCTTGCCCAGGTCACAGCAGG - Intergenic
1092541895 12:9425311-9425333 CTGCTTGCCCAGGTCACAGCAGG + Intergenic
1092635801 12:10447140-10447162 AAGCTGTCCTGGGTCACATGCGG - Intronic
1093590594 12:20897180-20897202 CTGCTGTCCTTTGTCAAAGCAGG + Intronic
1094317293 12:29148589-29148611 CTGCGTTCGTGGGTCACTGCAGG + Intergenic
1094511116 12:31097128-31097150 CTGCTTGCCCAGGTCACAGCAGG - Intronic
1095770302 12:45947461-45947483 CTGCTTTCCTGTGTTGCAGCAGG - Intronic
1096925040 12:55135145-55135167 CTGCTGTCCTGGGAACCACCTGG + Intergenic
1097977262 12:65700397-65700419 CTACTGTACTGTGGCACAGCAGG - Intergenic
1098226067 12:68326171-68326193 CTGCTCTCTTATGTCACAGCTGG - Intronic
1103323287 12:120103856-120103878 CTGCAGATCTGGGACACAGCGGG - Exonic
1103736825 12:123065876-123065898 CTGCTGTCCAGGATGACAGAGGG - Intronic
1104554768 12:129789703-129789725 CTGCTGCCCTTGGTCCCATCTGG - Intronic
1104578062 12:129986489-129986511 CTGATGTCCTGGGTCTCAACTGG - Intergenic
1104704593 12:130933808-130933830 CTGCTCTCATGAGTCACAGCAGG + Intergenic
1104743487 12:131195449-131195471 GTGCTAACCTGGGTCGCAGCAGG - Intergenic
1104790846 12:131481235-131481257 GTGCTAACCTGGGTCGCAGCAGG + Intergenic
1105501917 13:20980329-20980351 CAGCTGTGCTGGGTCAGGGCTGG + Intronic
1106235990 13:27860926-27860948 CTGCTGTCCTGCTTCCGAGCTGG + Intergenic
1106346649 13:28886059-28886081 CTGCTGTTCTGTGCCACACCAGG - Intronic
1106509213 13:30398638-30398660 CTGCTATCCTGAGTCAGCGCTGG - Intergenic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1108284604 13:48894080-48894102 TTGCTTTCCTGGGTCACTGTGGG - Intergenic
1110870934 13:80451977-80451999 CTGGTGGCCTGGGTCCCAGAGGG - Intergenic
1112722844 13:102264769-102264791 CTGTTGTCAAGGGACACAGCTGG + Intronic
1113816568 13:113175802-113175824 CTGCTCTCCTAAGTCACACCCGG - Intergenic
1115258364 14:31426884-31426906 CTGCTGTCCCTGGCCACTGCAGG - Intronic
1117764703 14:59069691-59069713 CAACTGCCCTGGCTCACAGCTGG + Intergenic
1118630173 14:67695458-67695480 CAGCTGTCCTGGGTGCCAGGAGG - Intronic
1119484398 14:74978441-74978463 GGGGTGGCCTGGGTCACAGCTGG + Intergenic
1119657667 14:76428990-76429012 CTGCAGCCCTGGGTCCCAGAGGG + Intronic
1121334477 14:93069092-93069114 CTGCTGCCCTCTGTCACTGCAGG + Intronic
1121422429 14:93824941-93824963 CCGCTGCCCTGGTACACAGCAGG + Intergenic
1122313730 14:100813431-100813453 CTGCTCTCCTGTGGCTCAGCAGG + Intergenic
1122369429 14:101221159-101221181 CGGCTGTCCTCGGTCACAAGAGG - Intergenic
1122828910 14:104386055-104386077 CTGCTGTCCAGAGGCACCGCTGG + Intergenic
1123132453 14:105999630-105999652 CTGGTGTCCTGGGTGACCCCTGG + Intergenic
1123203631 14:106691825-106691847 CTGCTGTCCTGAGTGCCACCTGG + Intergenic
1124662393 15:31560872-31560894 CTGCTGTTCCGGGTGAAAGCTGG - Intronic
1125758756 15:42083382-42083404 CTGCTGTCCCAGGTCCGAGCTGG - Intronic
1127065233 15:55230410-55230432 CTGCAGTTATGGGACACAGCAGG - Exonic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1129956703 15:79643635-79643657 CTGTTGTCCAAGGTCACAGGAGG + Intergenic
1130982169 15:88820284-88820306 TTGCCGTCCTCGATCACAGCAGG - Intronic
1131153886 15:90063153-90063175 GAGCTGTCCTGGGTCACCACAGG - Intronic
1131399149 15:92110739-92110761 CTCATGTCCTGGTACACAGCAGG + Intronic
1131961258 15:97792412-97792434 CTTCTCTCCTGGGTCAGAGGGGG - Intergenic
1132809862 16:1792356-1792378 CTGCTGTCCTGGGTGGCACTGGG - Exonic
1133019453 16:2960776-2960798 CACCTCTCCTGGGTGACAGCTGG - Intergenic
1133997489 16:10759379-10759401 CTCCTGTCCAGGGTCCCAGCTGG - Intronic
1134523086 16:14927527-14927549 CTGCTGTCCTGTGTGAACGCAGG + Intronic
1134549544 16:15132531-15132553 CTGCTGTCCTGTGTGAACGCAGG - Intronic
1134710753 16:16326178-16326200 CTGCTGTCCTGTGTGAACGCAGG + Intergenic
1134718924 16:16370466-16370488 CTGCTGTCCTGTGTGAACGCAGG + Intergenic
1134948848 16:18342467-18342489 CTGCTGTCCTGTGTGAACGCAGG - Intergenic
1134955832 16:18381693-18381715 CTGCTGTCCTGTGTGAACGCAGG - Intergenic
1136154695 16:28374859-28374881 CTGCTGGAGAGGGTCACAGCCGG - Intergenic
1136208397 16:28740399-28740421 CTGCTGGAGAGGGTCACAGCCGG + Intergenic
1136264486 16:29107075-29107097 CTGCTGGAGAGGGTCACAGCCGG + Intergenic
1137599000 16:49743631-49743653 CTGCTGCCCCGGGACACAGGGGG + Intronic
1137601722 16:49760766-49760788 GTGCTGTCCTGAGTCTCAGGGGG - Intronic
1138578324 16:57923041-57923063 CTGCTGGCCGTGGACACAGCTGG + Intronic
1139485369 16:67253196-67253218 CTGCTGTCCTGGCTCTCCCCAGG + Intronic
1139996627 16:70987050-70987072 GTGCTGTGCTGGGTCAGAGTTGG - Intronic
1141992840 16:87620336-87620358 CTGGTGTCATGGGCCAGAGCGGG + Intronic
1142598370 17:1040426-1040448 CTGCCGTGCTGGGTCATGGCAGG + Intronic
1143491084 17:7285570-7285592 CTGCTGTCCCGGGTTAGAGCAGG - Intronic
1144440493 17:15276903-15276925 CTGCTGACCTCAGTCATAGCTGG + Intergenic
1146309589 17:31756962-31756984 CTTCTGTCCTGGTTCATAGATGG - Intergenic
1147453405 17:40519990-40520012 CTGCTTCCCTGGGTCTCAGTTGG - Intergenic
1147609993 17:41796249-41796271 CTGCCTGCCTGGGTCCCAGCTGG - Intergenic
1147769213 17:42856278-42856300 TTGGTGGCCTGGGTGACAGCTGG + Exonic
1147771948 17:42874097-42874119 TTGGTGGCCTGGGTGACAGCTGG + Intergenic
1149550799 17:57537967-57537989 CTGCTTCCGTGGGCCACAGCAGG - Intronic
1150258531 17:63769828-63769850 AAGCTGTCCTGGGTCACATGCGG + Intronic
1150417169 17:64997006-64997028 TTGCTGCCCTGTGGCACAGCAGG - Intergenic
1150716688 17:67578326-67578348 CTGCTGGCCCTGGTCACAGAGGG - Intronic
1150794492 17:68226916-68226938 TTGCTGCCCTGTGGCACAGCAGG + Intergenic
1151277143 17:73043675-73043697 CTCCTGCCCTGTGTCACATCTGG - Intronic
1152429083 17:80237451-80237473 CTGCTTTCATGGGTCACTGCTGG + Intronic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1152656097 17:81519806-81519828 CTCCTGTCCTCGGTCGCAGGAGG - Intronic
1154071844 18:11159794-11159816 CTGCTGTCCTGGGGCGCTGTGGG - Intergenic
1154148654 18:11887952-11887974 CTGTTGACCTTGGACACAGCAGG - Intronic
1154494399 18:14945043-14945065 CAGATGGCCTGGGGCACAGCAGG + Intergenic
1155184743 18:23377223-23377245 CTGCAGTCCTGGGCCATAGCAGG - Intronic
1157690977 18:49681414-49681436 ATACTGTCCTGGGTAATAGCAGG - Intergenic
1157805711 18:50656059-50656081 CTGGGGTCCTGGGTCTCACCTGG - Intronic
1158762351 18:60404768-60404790 CTCCTGCCCTGAGTCACAGGAGG - Intergenic
1159051820 18:63427370-63427392 CTGAAGTCCTTGATCACAGCAGG - Intergenic
1159620932 18:70637578-70637600 GTGCTATCCTGGCTCACAGCAGG + Intronic
1160707158 19:535056-535078 CGGCCCTCCTGGGCCACAGCAGG - Intronic
1161370692 19:3909335-3909357 CTGCTGTCCTGGCGGACTGCAGG - Intronic
1162050199 19:8028365-8028387 CTGCTCTCCTGGGTCAATGCAGG + Intronic
1163127271 19:15251114-15251136 ATGGTGGCCTGGGACACAGCTGG + Intronic
1163303603 19:16463257-16463279 CTGCTGTCCTGGCTCCCTGAAGG + Intronic
1163313251 19:16526340-16526362 CCGGTGTCTAGGGTCACAGCTGG + Intronic
1163369333 19:16893328-16893350 CTCATCTCCAGGGTCACAGCCGG - Exonic
1163833953 19:19562274-19562296 GGTCGGTCCTGGGTCACAGCTGG + Intronic
1164829650 19:31310687-31310709 GTTCTGTCCTGAGCCACAGCAGG + Intronic
1165015187 19:32875458-32875480 CCTCTCTGCTGGGTCACAGCTGG - Intergenic
1167095139 19:47371299-47371321 CTGCTGCTCAGGGTCACAGTGGG + Intronic
1167432928 19:49463790-49463812 CTGCAGTCCTCGGTCTCAGCAGG + Intronic
1167849683 19:52191799-52191821 CTGCTGACCTGTTTCACATCTGG - Intronic
1168080615 19:54007618-54007640 CTGCTGTGGTGGCTCACACCTGG + Intronic
1168501147 19:56894614-56894636 CTGCTCTCCTGGGCCAGACCTGG + Intergenic
1168636499 19:58001220-58001242 CTGCAGTCATGGGTCAGAGCTGG - Intronic
925744584 2:7033332-7033354 CTGCTGGCTTGGGCCTCAGCTGG + Intronic
926276974 2:11411408-11411430 CTGCTGTCCTGTGTTAGATCTGG - Intergenic
927138859 2:20116065-20116087 GTTCTGTGCTGGCTCACAGCAGG - Intergenic
927849457 2:26489762-26489784 CTGCTGCCCTCAGTGACAGCAGG - Intronic
928609430 2:32977198-32977220 CTGTTGTCCTGGGAAACACCTGG - Intronic
928693107 2:33820918-33820940 CTGGTGTCCTGTGTCCAAGCGGG - Intergenic
929754125 2:44749784-44749806 CTGCTGTCCTCGCTCAGAGGGGG - Intronic
930000735 2:46859956-46859978 CTTCTGTCATAGGACACAGCCGG + Intergenic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
932832309 2:75002399-75002421 CTGAGGTCCTGGGTCCCAGTGGG + Intergenic
934718469 2:96556713-96556735 CTGCTGTGCTGGGTGACGCCAGG + Intergenic
935806054 2:106748672-106748694 CTAGTGTCCTGGGGCACATCGGG - Intergenic
937681008 2:124644738-124644760 CTGTTCTCCTGGGAGACAGCAGG - Intronic
938885162 2:135639023-135639045 CTGCTGGCTTTGGTTACAGCAGG - Exonic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941656308 2:168148419-168148441 CTGCTGTCCTGACTCAAAGGAGG + Intronic
941714410 2:168748902-168748924 CTGCTTCCCTGGGGCACTGCAGG - Intronic
943939302 2:193970577-193970599 AAGCTGTCCTGGGACACAGGTGG + Intergenic
944259162 2:197657322-197657344 CTTCTGCCCTGGGTCACCCCAGG + Intronic
946610904 2:221456661-221456683 CTGCTGTCCTGGCTCGCACGTGG + Exonic
946909541 2:224445813-224445835 CTGCTGTACTGAGTCAGAGCTGG + Intergenic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
947838007 2:233189160-233189182 CTGCTGGCCTGGCTGGCAGCGGG - Intronic
947915910 2:233831387-233831409 CTGCCGTCCTGTGTCCCTGCAGG + Exonic
948167304 2:235872993-235873015 CTGCCCTCCTGGGGCACGGCTGG - Intronic
948217113 2:236240016-236240038 CTGCTGTCCTGTGGTACACCTGG - Intronic
948459805 2:238123678-238123700 CAGCTGTCCTGGGACACCGGGGG - Intronic
948753342 2:240144838-240144860 TTGTTGTCCTCGGTCCCAGCAGG + Intergenic
948853349 2:240718914-240718936 CTGCAGCCCTGCGTCAGAGCAGG - Intronic
949047790 2:241880104-241880126 CTGCACTCCTGGATCACACCTGG - Intergenic
1170950747 20:20933738-20933760 CGCCTGTCCAGGGTCACAGCTGG - Intergenic
1172641942 20:36445749-36445771 GGGCTGGCCTGGGCCACAGCGGG - Intronic
1172828600 20:37812369-37812391 ATAAAGTCCTGGGTCACAGCTGG - Intronic
1173454363 20:43190838-43190860 CTGCTGTCCTGGGAGGCAGCTGG + Intergenic
1173564425 20:44028842-44028864 TGGCTGCCCTTGGTCACAGCAGG - Intronic
1175321688 20:58092754-58092776 TTGGTGACCTGGCTCACAGCAGG + Intergenic
1175516021 20:59570621-59570643 AAGCTGTCCTGGGTCACATGTGG - Intergenic
1175543037 20:59760098-59760120 GGGCTGTCCTGGGTCACTCCTGG + Intronic
1175578603 20:60081109-60081131 CCGCTGTCCTGGGACACCGGTGG + Intergenic
1175625506 20:60485469-60485491 CAGATGTTCTGGGTCAGAGCTGG - Intergenic
1175788845 20:61728975-61728997 CTGCTGCCCTGAGTCACTGCAGG - Intronic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1177859630 21:26437715-26437737 CTGCTGTCCTGTTCCACAGGAGG + Intergenic
1179159247 21:38878540-38878562 CAGCTCTCTTGGGTAACAGCAGG - Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180255573 21:46624988-46625010 CTGCTGTCGTGGATCGGAGCAGG + Intergenic
1181535531 22:23540986-23541008 CAGCTGTCCCGCGCCACAGCAGG + Intergenic
1181552700 22:23649774-23649796 CTGCAGGCCTGGGTCACCCCTGG + Intergenic
1182011653 22:27006301-27006323 CTGCTGTCCTTGCTCACAGTGGG + Intergenic
1182037830 22:27213397-27213419 CTGGTGTCCTGGGGTCCAGCAGG + Intergenic
1182120690 22:27784471-27784493 CTGGTGTCCTAGTTCTCAGCAGG - Intronic
1182147474 22:28005571-28005593 CTGCTGGCCTGGGTCAGTGGTGG + Intronic
1183424960 22:37734512-37734534 CTGATGTCCTGGGGGGCAGCGGG - Exonic
1183669599 22:39264665-39264687 CTCCACTTCTGGGTCACAGCTGG - Intergenic
1183706985 22:39480313-39480335 CTGCCTGCCTGGGTCACAGAGGG + Intronic
1184253150 22:43272214-43272236 TTGGGGTCCTGGGTCCCAGCTGG + Intronic
1184310038 22:43635290-43635312 CCCCTGTGCTGGCTCACAGCAGG + Intronic
1184480821 22:44745875-44745897 CTGCTGCCCTGGTTGACAGCAGG - Intronic
1184652587 22:45925917-45925939 CAGCCATCCTGGGCCACAGCAGG - Intronic
1185087405 22:48748414-48748436 CTTGTGGCCTGGGTCACAGCTGG - Intronic
1185119199 22:48955795-48955817 GTGCCGTCGTGGGGCACAGCGGG - Intergenic
952852744 3:37742226-37742248 CTCCAGTCCTGGCTCACAGGAGG + Intronic
952965043 3:38615939-38615961 CTGCTGTCCTTAGCCACACCCGG - Intronic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
956849087 3:73211924-73211946 CTGCTCTCCTGTGTACCAGCTGG + Intergenic
959070212 3:101694972-101694994 CAGCTGTCCCGCGCCACAGCAGG + Intergenic
960635754 3:119782734-119782756 CTGCTGTCCTTGGCCTCAGGGGG - Exonic
961436036 3:126917301-126917323 CTTTTGTCCGTGGTCACAGCTGG + Intronic
962252022 3:133841362-133841384 CTGCAGCTCTGGGACACAGCTGG - Exonic
962276564 3:134019029-134019051 CTGCTCCCCTTGGTCACAGCTGG + Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
964526039 3:157616118-157616140 ACGCTGCCCTGGGTCACAGATGG - Intronic
965151742 3:164986357-164986379 CTGCTTTTCTGTGTAACAGCTGG + Intronic
965759876 3:172064222-172064244 CTCCTTTCCTGGTTCACAGATGG - Intronic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968829620 4:2926263-2926285 CTTCTGTCCTGGGTAACTCCAGG + Intronic
969183831 4:5461168-5461190 GTGCTCTCCTAGGTCACAGATGG - Intronic
969240761 4:5895701-5895723 AACCTGTCCAGGGTCACAGCTGG + Intergenic
970172045 4:13300056-13300078 CTGCTGTCATGGTTCACATGCGG + Intergenic
971454494 4:26831511-26831533 CTGCTGCCATGGGTCACATCTGG - Intergenic
972780367 4:42281985-42282007 CTGCTGTTCAGAGTCAGAGCTGG - Intergenic
980688422 4:136260456-136260478 CTCCTGTCCTGGCTGAAAGCAGG - Intergenic
983948000 4:173608333-173608355 CTGTTTTCCTGGGTATCAGCAGG + Intergenic
985578072 5:682863-682885 CAGCAGTGCTGGGTCAAAGCTGG + Intronic
985689816 5:1300962-1300984 CTGCTGGCCTGGGTTTGAGCAGG + Intergenic
986547766 5:8917881-8917903 ATGCTGTCCTCTGTCACACCTGG - Intergenic
989143039 5:38220989-38221011 CTGCTTTTCTGTGTAACAGCTGG - Intergenic
992071414 5:73152557-73152579 ATGCTGCCCTGGGACCCAGCTGG - Intergenic
992406440 5:76461900-76461922 CTCCACTCCTGAGTCACAGCTGG + Intronic
993328309 5:86568127-86568149 CTGCCGTCAGGGGTCCCAGCAGG + Intergenic
994005897 5:94836848-94836870 CTGCTTTCCTGGGACACATATGG - Intronic
997408964 5:133675630-133675652 CTGCTGGACTGGGTCACATGAGG + Intergenic
997993421 5:138565493-138565515 CCGGTGTCTTGGGTGACAGCAGG - Intronic
998754234 5:145358436-145358458 CTGTTGTCCTGGGAAACACCTGG - Intergenic
1001691696 5:173638165-173638187 CTGCTGGCCTGGCACACAGTAGG + Intergenic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002296625 5:178234918-178234940 TAGCTGTCATGGGACACAGCAGG + Intergenic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1003174951 6:3747359-3747381 CTGCTGTGCTGGGAAAGAGCAGG - Intronic
1004066983 6:12256555-12256577 ATGCTTACCTGGGTCACAGACGG - Intergenic
1005957575 6:30675084-30675106 CTGTTTTCCTGGGTCACAACTGG + Intergenic
1006583015 6:35087472-35087494 CTGCTGTACTGAGCCACAGCTGG + Intronic
1006688851 6:35862106-35862128 CTGCTTGCTTGGGTCCCAGCGGG + Intronic
1006794934 6:36725912-36725934 CTGCAGCTCTGGGACACAGCTGG + Exonic
1007635961 6:43299881-43299903 CTCCTGTCCTGGCCCAGAGCTGG + Exonic
1007651929 6:43427923-43427945 CGGCTGTGCAGGGTAACAGCCGG - Intronic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1013448594 6:110256539-110256561 CAGAGGTCCTGGCTCACAGCAGG + Intronic
1013888865 6:115001749-115001771 CTGCTGAACTGGGGCACAGAAGG - Intergenic
1015214408 6:130733438-130733460 CTGTAGTCCAGGGCCACAGCAGG - Intergenic
1016363460 6:143291736-143291758 CTGCTTTCCTTGAACACAGCAGG - Intronic
1017733559 6:157339683-157339705 CTGCTGTCCCCAGTCACAGGAGG + Intergenic
1019056453 6:169227132-169227154 CTGCTGTTCTGTCTCACAGCGGG - Intronic
1019300738 7:302244-302266 CTGCTATCCTGGGCCTGAGCTGG + Intergenic
1019434620 7:1015620-1015642 CTGCTCTCCTGGGTCAGTCCTGG - Intronic
1019955524 7:4411332-4411354 CTGCTGACCTGGACCTCAGCTGG + Intergenic
1020141357 7:5613789-5613811 CTGCACACATGGGTCACAGCAGG + Intergenic
1020260518 7:6528412-6528434 CAGCTGGCCTGTGGCACAGCTGG + Intronic
1021974526 7:25998773-25998795 CTGCTGCCCATGGTCACCGCTGG - Intergenic
1022990840 7:35705559-35705581 CTTATTTCCTGGGGCACAGCTGG - Intergenic
1023869227 7:44254045-44254067 CATCTGGCCTGGGCCACAGCAGG + Intronic
1023930259 7:44701071-44701093 CTGCTGCCCTGGGATACCGCGGG + Intronic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025083849 7:56006813-56006835 CTGCTGTCCTCTTTAACAGCTGG - Intergenic
1025942817 7:66086495-66086517 CTGCAGGCCTGGGTCACCCCTGG - Intronic
1028142870 7:87291220-87291242 CTGCTGTCCTGGGAAGCACCTGG + Intergenic
1028928381 7:96385836-96385858 CTCCTGCCCTAGGTCCCAGCTGG + Intergenic
1030105607 7:105984348-105984370 CTGCTGTCCTGAGTCTTGGCGGG + Intronic
1032162673 7:129522782-129522804 CTGCTGTCCTTGGTGCCGGCTGG - Intergenic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032521949 7:132552212-132552234 ATGGTGTCCAGGATCACAGCTGG + Intronic
1033053545 7:138028872-138028894 CTGTTGTCCTGGGTAAAATCTGG - Intronic
1033215159 7:139487910-139487932 CTGCTGTGCTGTGTCACAGGAGG - Intergenic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1034437053 7:151067704-151067726 CAGTTGTCCAGGGTCCCAGCTGG + Intronic
1035098096 7:156373103-156373125 CTGCTATCCTGGCTCTCATCAGG - Intergenic
1035300018 7:157891059-157891081 GTCCTCTCCTGGGTCACACCTGG + Intronic
1035322553 7:158042679-158042701 TGGCTGTCCTGAGCCACAGCCGG + Intronic
1035585430 8:769254-769276 TTGCAGTCTTGGGTCTCAGCAGG + Intergenic
1035777617 8:2200500-2200522 CTGCTGTCCTTGGTGACTGGAGG + Intergenic
1036190508 8:6665560-6665582 CTGCTTTTCTGTGTAACAGCTGG + Intergenic
1036199366 8:6754541-6754563 CTCCTGACCTGGCACACAGCTGG - Intronic
1038328727 8:26591246-26591268 CTGCTGGCCTGATTGACAGCTGG + Intronic
1039688731 8:39838189-39838211 TTGAAGTCCTGGGTCCCAGCCGG + Exonic
1039790634 8:40872943-40872965 CTGCTGTGCTGGTCCACAGAGGG - Intronic
1041441538 8:57902068-57902090 CTGCCGCTCTGGGTCACACCAGG + Intergenic
1042352060 8:67787419-67787441 ATGCTCTCCTGAGTCTCAGCAGG + Intergenic
1042945674 8:74152422-74152444 CAGCTTTCCTGAGCCACAGCTGG + Intergenic
1044419665 8:91979871-91979893 TTGCTGTCCTGGGTCATATGAGG - Intronic
1045034170 8:98164690-98164712 CTGGTGTTCTGGGTCACTGTGGG + Intergenic
1045567971 8:103340499-103340521 GTGGTCTCCTGGGCCACAGCTGG - Intergenic
1048779155 8:137982391-137982413 TGGCTGTCCTGGGGCACCGCAGG - Intergenic
1049262965 8:141649523-141649545 CCACCGTCCTGGGTCTCAGCTGG + Intergenic
1049322119 8:142002098-142002120 CTGCAGCCCTGGGTCACATGTGG + Intergenic
1049603284 8:143517928-143517950 CTGCTGTCCTGGCCCCGAGCAGG - Intronic
1049806896 8:144545170-144545192 CTGCTGTGCTGGGCGGCAGCTGG - Intronic
1051396432 9:16626850-16626872 CTGCTATCTTGGCTCACTGCTGG - Intronic
1053611866 9:39722128-39722150 CTGTTTACCTGGGTCAGAGCGGG + Intergenic
1053833392 9:42108447-42108469 GTGCTGAACTGGGTAACAGCTGG + Intronic
1053869903 9:42480122-42480144 CTGTTTACCTGGGTCAGAGCTGG + Intergenic
1054086390 9:60749027-60749049 CTGTTTACCTGGGTCAGAGCGGG - Intergenic
1054241655 9:62620265-62620287 CTGTTTACCTGGGTCAGAGCGGG - Intergenic
1054555781 9:66654788-66654810 CTGTTTACCTGGGTCAGAGCGGG - Intergenic
1054597158 9:67078964-67078986 GTGCTGAACTGGGTAACAGCTGG - Intergenic
1056658957 9:88530916-88530938 TTGGTGTCCTGGGCCACACCTGG - Intergenic
1059908153 9:119011706-119011728 CTGCTGCTCAGGGACACAGCAGG + Intergenic
1060743761 9:126116597-126116619 CTGCTTTCATGGGACACCGCTGG + Intergenic
1060992356 9:127856412-127856434 CACCTGCCCTGGGTCACAGGTGG + Intergenic
1061041977 9:128145610-128145632 CAGCTCTCCTTGGTCACGGCAGG - Intergenic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061817170 9:133204482-133204504 CTGCTGGCCTGGCTCACTTCAGG + Intergenic
1061844156 9:133377355-133377377 CTGCTGTTCTAAGCCACAGCGGG - Intronic
1062101769 9:134732167-134732189 CCGCTGCTCGGGGTCACAGCGGG + Intronic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062476519 9:136730381-136730403 GTCCTCTCCTGGGTCTCAGCAGG - Intergenic
1062629055 9:137455490-137455512 CTGCGGGCCTGGCTCCCAGCGGG - Intronic
1203453224 Un_GL000219v1:140405-140427 AAGCTGTCCTGGGTCACATGTGG - Intergenic
1186624242 X:11275403-11275425 CAGTTTTCCTGGGTCACTGCAGG - Intronic
1186849907 X:13569895-13569917 CTGCTCTCCTGGGTGGCAGGTGG + Exonic
1187831758 X:23389334-23389356 CAGCTGTCCTGGCTCATAGCTGG - Intronic
1188581357 X:31717905-31717927 CTGTTGCCCTGGGCCACAGCTGG - Intronic
1189063938 X:37785921-37785943 CTTCCCTCCTGGGTCACAGGAGG - Intronic
1189299688 X:39943515-39943537 CTGATGTCCAGGGCCTCAGCTGG - Intergenic
1189318640 X:40073936-40073958 CCACGGTCCTGGTTCACAGCAGG - Exonic
1190296401 X:49030195-49030217 CTGCTGGCCTTGGAGACAGCAGG + Exonic
1192221554 X:69200707-69200729 CTGCTGCCTTGGGACTCAGCAGG + Intergenic
1192510380 X:71717644-71717666 CTGCGGTCCTGGGCCAGTGCGGG - Exonic
1192516317 X:71763909-71763931 CTGCGGTCCTGGGCCAGTGCGGG + Exonic
1192723794 X:73726995-73727017 CTGCTTTCCAAGGTGACAGCAGG - Intergenic
1192849723 X:74942322-74942344 CTGTTGTCCTGGGAAACACCTGG - Intergenic
1195064992 X:101232500-101232522 CTGCAGTGCTGAGTCACTGCTGG + Intronic
1196819613 X:119692656-119692678 GTGCGGTCCCGGGTCACAACGGG + Intronic
1198075748 X:133191228-133191250 CTGGAGCCCTGGGTCTCAGCAGG - Intergenic
1200096577 X:153667402-153667424 CTGCTGTTCTGGGCCACACAGGG - Intergenic
1201935809 Y:19409835-19409857 CTGCTGCCCTGTGTCACCTCAGG + Intergenic