ID: 1127806578

View in Genome Browser
Species Human (GRCh38)
Location 15:62526553-62526575
Sequence GGTTAGTTACAGTCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127806564_1127806578 29 Left 1127806564 15:62526501-62526523 CCCAGTGAAGCCAGCACTGTGAG 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806565_1127806578 28 Left 1127806565 15:62526502-62526524 CCAGTGAAGCCAGCACTGTGAGC 0: 1
1: 0
2: 1
3: 33
4: 989
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806566_1127806578 19 Left 1127806566 15:62526511-62526533 CCAGCACTGTGAGCCAATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 233
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806571_1127806578 1 Left 1127806571 15:62526529-62526551 CCAGGCCCCTGGTTTGGAATGCC 0: 1
1: 0
2: 1
3: 18
4: 149
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806574_1127806578 -5 Left 1127806574 15:62526535-62526557 CCCTGGTTTGGAATGCCTGGTTA 0: 1
1: 0
2: 1
3: 16
4: 128
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806563_1127806578 30 Left 1127806563 15:62526500-62526522 CCCCAGTGAAGCCAGCACTGTGA 0: 1
1: 1
2: 1
3: 28
4: 276
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806573_1127806578 -4 Left 1127806573 15:62526534-62526556 CCCCTGGTTTGGAATGCCTGGTT 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806575_1127806578 -6 Left 1127806575 15:62526536-62526558 CCTGGTTTGGAATGCCTGGTTAG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1127806570_1127806578 6 Left 1127806570 15:62526524-62526546 CCAATCCAGGCCCCTGGTTTGGA 0: 1
1: 0
2: 2
3: 15
4: 152
Right 1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127806578 Original CRISPR GGTTAGTTACAGTCATCTCA GGG Intronic
902898467 1:19496209-19496231 GGTTAGACACAATCATCTCAGGG + Intergenic
904327975 1:29739762-29739784 GGATGGATACAGTCATGTCAGGG + Intergenic
907762915 1:57379079-57379101 GGTTCTTTACAGTTATCTCAAGG + Intronic
916883895 1:169048342-169048364 GGTTTGCAACAGTGATCTCATGG + Intergenic
918715121 1:187776475-187776497 CGTTAGTTTCAGGCATCCCATGG + Intergenic
919415512 1:197303496-197303518 AGCTAGATACAGTCATCTGATGG - Intronic
924499185 1:244620517-244620539 TGTAAGTTACAATAATCTCATGG + Intronic
1065535952 10:26714952-26714974 GTTTTGTTACAGTCTTTTCAGGG - Intronic
1065885193 10:30070617-30070639 AGTTAGTTACAGTAACCTCCAGG - Intronic
1067670050 10:48311516-48311538 GGTTTGTTATAGACATCTAAAGG + Intronic
1071307519 10:84312293-84312315 GATTAGTTACAGTCAAATAAAGG + Intergenic
1077758264 11:5059809-5059831 GGTAAGTAACAAACATCTCAGGG + Intergenic
1081010485 11:37805454-37805476 GGTTATTCCCAGTCAACTCAAGG - Intergenic
1087648284 11:100833501-100833523 GCTGGGTTGCAGTCATCTCAAGG + Intronic
1092839659 12:12527883-12527905 GGTTGTTTACATACATCTCAAGG + Intronic
1093926958 12:24918173-24918195 GTTTACTTACTGTCTTCTCATGG - Intronic
1097109087 12:56644957-56644979 TGTTAGATACAGGCATCGCAGGG + Intronic
1100127637 12:91448390-91448412 GGTTAGTTACATTCGTCACTAGG - Intergenic
1107914416 13:45134581-45134603 GGGTAGGTACAGTCATCGTAAGG + Intronic
1115349266 14:32375893-32375915 GGTAAGTTAGAGTCATATCACGG - Intronic
1117976828 14:61306844-61306866 TGTTAATTACAGTCATTTAAAGG - Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120161238 14:81147284-81147306 AGTTAGTTACCATCAACTCAAGG - Intergenic
1120167314 14:81215269-81215291 GCTTATTTACAGTTATCTCAAGG + Intronic
1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG + Intronic
1131731293 15:95283953-95283975 GATGAGTTCCAGTCATGTCAGGG + Intergenic
1137076638 16:35973427-35973449 GGATATGTACACTCATCTCATGG - Intergenic
1138860952 16:60756397-60756419 GGTTACTTATAGTTATATCAAGG + Intergenic
1139393962 16:66624956-66624978 GTTTAGTTACACTCAGCTCTGGG + Intronic
1141769372 16:86079928-86079950 GTGTAGTTACAGTCATCCCTTGG + Intergenic
1146465657 17:33084186-33084208 GGTCATTTGAAGTCATCTCATGG + Intronic
1149724888 17:58883320-58883342 TGTTTGTTACAGTTATCTCTTGG + Intronic
1153432179 18:5029726-5029748 TGTTAGTGACAGGCATGTCATGG + Intergenic
1156047284 18:32890691-32890713 GCTTATTTTCAGTCACCTCAGGG - Intergenic
1156203570 18:34860847-34860869 GGTTTGTTACAGTAATTTTACGG - Intronic
1166426911 19:42687158-42687180 AGTTAGATACAGTTATCACAGGG + Intronic
926362189 2:12100222-12100244 CGATAGTAATAGTCATCTCATGG + Intergenic
930275576 2:49306979-49307001 GGTTTCTCACAGTAATCTCAAGG - Intergenic
932803448 2:74763061-74763083 GGTTAGTTACCTTCAACTGAAGG - Intergenic
934054013 2:88236599-88236621 GGTTAGTTCTAGGCATCTCTGGG + Intergenic
935545189 2:104393803-104393825 GGTAAGTTACAGTCTTTACAAGG - Intergenic
936384136 2:112013500-112013522 GGTTAGCCACTGTCATCCCAGGG - Intronic
939465707 2:142553162-142553184 GATTAGTTAACTTCATCTCAAGG + Intergenic
1175062418 20:56255809-56255831 GGGGAGTTACTGGCATCTCATGG - Intergenic
949279677 3:2331437-2331459 GGTTTGTTACTGTCATCTCATGG - Intronic
957163763 3:76644228-76644250 GGATAGTTTCAGTCATGGCAGGG - Intronic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
979000988 4:115219278-115219300 TTTTAGTTACAGGAATCTCAAGG + Intergenic
981123390 4:141078183-141078205 GGTTAAGTACAGGCATCTCTTGG - Intronic
981693324 4:147533501-147533523 AATTATTTACAGACATCTCAAGG + Intronic
988396706 5:30704999-30705021 GTACAGTTACAGTCATCACAGGG + Intergenic
999333792 5:150697583-150697605 GGATAGTCACAGTCATCTAAGGG + Intronic
1011140734 6:84153041-84153063 GGTTTCTTACAGTGATCTGATGG + Exonic
1014618876 6:123640425-123640447 GGTTATTTAATGTTATCTCAAGG - Intergenic
1022892586 7:34716213-34716235 GTTTTGTTATAGTCATCTCACGG - Intronic
1031272106 7:119664849-119664871 GGTTATTTTCAGTCATTCCAAGG - Intergenic
1031672351 7:124564884-124564906 GGCTCGCTACTGTCATCTCAAGG + Intergenic
1032422210 7:131791532-131791554 GATAAGCTGCAGTCATCTCAAGG - Intergenic
1043095040 8:75957304-75957326 AATTAGTTACAGGCCTCTCAAGG - Intergenic
1046600094 8:116306420-116306442 TGTCAGTTTCAGTCATCTCTTGG + Intergenic
1048813616 8:138310560-138310582 GGTTGGTTAAAGTCAAGTCAGGG - Intronic
1051283258 9:15465671-15465693 GGTTGGTTTCAGTCTTTTCATGG - Intronic
1051475408 9:17502210-17502232 AGTAGGTTACAGTCATCTCTAGG - Intronic
1186511464 X:10132981-10133003 GGTTACTTACTTACATCTCAGGG + Intronic
1187671755 X:21674253-21674275 GTTTTGTTACAGTAATATCAAGG - Intergenic
1187672866 X:21685960-21685982 GGTTAGGGACAGCCACCTCAGGG - Intergenic
1189870183 X:45372842-45372864 TCTTTGTTAAAGTCATCTCATGG - Intergenic
1195529264 X:105933270-105933292 GGTTATATCCAGTTATCTCAAGG + Intronic
1199698584 X:150361108-150361130 GGAGAGCTAGAGTCATCTCAGGG - Intergenic