ID: 1127807362

View in Genome Browser
Species Human (GRCh38)
Location 15:62533670-62533692
Sequence CAGGAGGGTTTGAATTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127807359_1127807362 -9 Left 1127807359 15:62533656-62533678 CCCATAAAAAATGCCAGGAGGGT 0: 1
1: 0
2: 3
3: 20
4: 238
Right 1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1127807355_1127807362 -7 Left 1127807355 15:62533654-62533676 CCCCCATAAAAAATGCCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1127807360_1127807362 -10 Left 1127807360 15:62533657-62533679 CCATAAAAAATGCCAGGAGGGTT 0: 1
1: 0
2: 0
3: 17
4: 153
Right 1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1127807354_1127807362 -6 Left 1127807354 15:62533653-62533675 CCCCCCATAAAAAATGCCAGGAG 0: 1
1: 0
2: 1
3: 11
4: 207
Right 1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1127807357_1127807362 -8 Left 1127807357 15:62533655-62533677 CCCCATAAAAAATGCCAGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG 0: 1
1: 0
2: 1
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127807362 Original CRISPR CAGGAGGGTTTGAATTATGA TGG Intronic
900857503 1:5197693-5197715 CAGGAAGCTTCCAATTATGATGG - Intergenic
906651753 1:47517688-47517710 CAGGAGAGTTTGGAAAATGATGG + Intergenic
907919079 1:58896330-58896352 AAGGAGGGCTTGAATGGTGAGGG - Intergenic
908316842 1:62941038-62941060 CAGGAGGGTTGGAAGGGTGATGG - Intergenic
908613457 1:65889125-65889147 CATGAGGGTTTTTATCATGAAGG + Intronic
909718791 1:78741327-78741349 CAGGATGGTCTCAATTATAAAGG - Intergenic
909882867 1:80902231-80902253 CAGGAGGCTTAGAATTAGCAAGG + Intergenic
912178876 1:107193702-107193724 TATGAGGGTTTGAACTAAGACGG - Intronic
912265748 1:108155988-108156010 CAGAACGGGTTGAATTCTGAAGG + Intronic
912332456 1:108832057-108832079 CAGGATGGTTGGAAGTATTAAGG - Intronic
912334827 1:108852603-108852625 CAGGAGGATTTGCCTTATGATGG - Exonic
912538517 1:110395012-110395034 TAGCAGGGCTTGAATTATGCAGG + Intergenic
914897729 1:151691835-151691857 AAGGAGGGTTAGAAGTATGAAGG + Intronic
915694000 1:157721026-157721048 CAAGAGGCTTTCAATTATAATGG + Intergenic
916695200 1:167228289-167228311 CAGGATGGTTTGAAATAGGAAGG + Intronic
917049108 1:170898288-170898310 CATGAGTGTTTGAAATTTGAGGG - Intergenic
918031310 1:180814913-180814935 AAGGAGGGAGTGAGTTATGAAGG + Intronic
918249606 1:182690228-182690250 CAGGGGGGCATGAATTATGAAGG - Intergenic
919485022 1:198135040-198135062 CTGAAGGGTTTATATTATGAGGG + Intergenic
920851388 1:209630465-209630487 CAGGAGAGCTTGAATTGTAATGG + Intronic
923421393 1:233819018-233819040 CAGGAGGCTTTTACTCATGATGG - Intergenic
924010000 1:239654329-239654351 AAGGAGGGATTCAATTTTGAGGG + Intronic
1064628308 10:17283678-17283700 CAGGAGACTTACAATTATGATGG - Intergenic
1065323095 10:24526846-24526868 AAGGAGGGTTAGAATGGTGAAGG + Intronic
1065369737 10:24971599-24971621 AAGTGGGGTTTTAATTATGAAGG + Intergenic
1066118786 10:32263614-32263636 CAGGAGGGTTTGATGGGTGATGG - Intergenic
1067493827 10:46743193-46743215 ATTGAGGGTTTTAATTATGAAGG + Intergenic
1067600829 10:47597211-47597233 ATTGAGGGTTTTAATTATGAAGG - Intergenic
1068238265 10:54267229-54267251 ACTGAGGGTTTTAATTATGAAGG - Intronic
1069154895 10:65016316-65016338 CACGATGGTGGGAATTATGATGG - Intergenic
1070908753 10:80099163-80099185 AAGTATTGTTTGAATTATGATGG - Intergenic
1071652371 10:87405081-87405103 ATTGAGGGTTTTAATTATGAAGG - Intergenic
1071664648 10:87542669-87542691 CAGGAGGCTTACAATCATGACGG - Intronic
1072020926 10:91400281-91400303 GAGGAGTTTATGAATTATGATGG - Intergenic
1072863119 10:99027956-99027978 TTTGAGGGTTTGTATTATGAAGG - Intronic
1073923792 10:108489804-108489826 TAGGATGGTTTGAATTGTTAGGG - Intergenic
1074246299 10:111697152-111697174 CAGCAGTGTTTGAATAATGTGGG + Intergenic
1074441469 10:113480810-113480832 CAGGAGGATTTGAATAGTCAAGG - Intergenic
1074525266 10:114257628-114257650 TAGCAGGGTGTGAATTCTGAGGG - Intronic
1075420333 10:122295610-122295632 CAGGAGGGTCTGAACTAGGCAGG + Intronic
1078936084 11:15951324-15951346 CAGTGGGGTTGGAATTATGGTGG + Intergenic
1080277368 11:30517705-30517727 CCAGAGGGGTTGAAGTATGAGGG - Intronic
1080649835 11:34213141-34213163 CAGCAGGGTTAGAATTTAGAAGG + Intronic
1081431366 11:42979873-42979895 GAGGAGGGTTTGAGGCATGAGGG + Intergenic
1084801397 11:71546677-71546699 CAGGGGGGTGTGAGTTCTGAAGG - Intronic
1086052279 11:82607385-82607407 CATTAGGATTTCAATTATGATGG - Intergenic
1086560169 11:88158719-88158741 CTTGAGGGTTTTTATTATGAAGG - Intronic
1087289712 11:96307094-96307116 CAGGAGAGTTTGTATTTTGTTGG - Intronic
1088277750 11:108106377-108106399 CATGATGTTTTGATTTATGAAGG + Exonic
1094432827 12:30388739-30388761 CAGGAAGCTTACAATTATGATGG + Intergenic
1095143684 12:38697861-38697883 CAGGAAGCTTTCAATCATGATGG - Intronic
1096556641 12:52407977-52407999 CAGGATGGTGTGAATGTTGATGG + Intergenic
1098745162 12:74227458-74227480 CAGGGAGGTTTTACTTATGATGG - Intergenic
1098745358 12:74231014-74231036 AAGGAGCTTTTGACTTATGATGG - Intergenic
1099745277 12:86694650-86694672 CAGTAGGATTTGAATTATCAAGG + Intronic
1102619560 12:114183128-114183150 CAGGAGGCTTAGAACTGTGAGGG - Intergenic
1104159618 12:126165657-126165679 CTGGAGGATTGGAATTAGGATGG - Intergenic
1105730506 13:23210979-23211001 CAGTTGGGTTTGAATTTGGATGG - Intronic
1107325897 13:39242082-39242104 CGGGAGTTTTTGTATTATGAAGG + Intergenic
1108594932 13:51941407-51941429 CATGTGGGTATGAATTAAGATGG + Intronic
1108827138 13:54426657-54426679 CAAGTGGGTTTTAATTTTGATGG + Intergenic
1110102093 13:71619722-71619744 TAGGAGGGATTCAATTATGTGGG + Intronic
1110671191 13:78180269-78180291 ATTGAGGGTTTGTATTATGAAGG + Intergenic
1111058303 13:82979354-82979376 CAGGTGGGTTTCATCTATGAGGG - Intergenic
1111417947 13:87974468-87974490 AAGGAAAGTTTGAATTAGGAGGG - Intergenic
1115615962 14:35095055-35095077 CAGGAGTGTCTCACTTATGATGG - Exonic
1116735628 14:48687046-48687068 CAGGAGGGTCTGAGTTAGAAAGG + Intergenic
1118738947 14:68724315-68724337 CTTGAGGGTTTGTATTGTGAAGG - Intronic
1119435803 14:74597163-74597185 CATGAGGGTTTGAAGGAAGATGG + Intronic
1119635140 14:76267538-76267560 CAAGAGGAGTTGAATTATGCTGG + Intergenic
1123002965 14:105306195-105306217 CAGCAGGGTTAGAGTTTTGAAGG + Exonic
1124964483 15:34423142-34423164 CAGGAAGGTTCGAAGTGTGATGG - Intronic
1126133949 15:45372715-45372737 CAGGAAGGTTTAATTTATCAAGG - Intronic
1127807362 15:62533670-62533692 CAGGAGGGTTTGAATTATGATGG + Intronic
1131377333 15:91936513-91936535 CTGGAGGGTTTAAACTTTGAGGG + Intronic
1131629689 15:94163378-94163400 CAGGAGGCTTTGAATTATAGTGG + Intergenic
1131662921 15:94537961-94537983 AAGAAGTGATTGAATTATGAGGG + Intergenic
1133878057 16:9753192-9753214 CAGGAAGCTTTTAGTTATGACGG - Intergenic
1137916761 16:52440066-52440088 CAGGAGGGCATGAATAATGGTGG - Intronic
1138316881 16:56077811-56077833 CAGGAAGCTTTCAATCATGATGG - Intergenic
1140564300 16:76023226-76023248 CTAGAGGGTTTCAATTATAATGG - Intergenic
1140626869 16:76804647-76804669 AAGGAGGGTTTAAAGTTTGACGG + Intergenic
1141916987 16:87105216-87105238 TAGCAGGGTTTGAATTAGAATGG + Intronic
1141923482 16:87152190-87152212 CAGGAAGGTTTCAATCATGGCGG - Intronic
1144787136 17:17838121-17838143 CAGGATGGCTTGACTTATGAAGG - Intergenic
1146116601 17:30146281-30146303 CAGAAGAGTTTTAATTTTGAAGG - Intronic
1146506719 17:33412307-33412329 CAGGATGTCATGAATTATGATGG + Intronic
1146576901 17:34002034-34002056 GAGGAGAGTTTGAATCTTGAGGG - Intronic
1151556857 17:74851050-74851072 CAGAAGGGTTTGGAGCATGAAGG - Intronic
1154260693 18:12829636-12829658 CAGGAGAGGTTGAATTATTATGG - Intronic
1155815730 18:30306946-30306968 AAGGAGGGTCTGAATTGGGAAGG - Intergenic
1157680750 18:49603474-49603496 CTGGACTGTTTGAATTCTGAGGG - Intergenic
1159349698 18:67256584-67256606 AAGGAGGGGTCAAATTATGATGG - Intergenic
1159419075 18:68192223-68192245 GCGGAGGGTTTGTATCATGAAGG + Intergenic
1162209921 19:9083095-9083117 CAGGAATGTTTGCATTATCAGGG + Intergenic
1165375936 19:35441807-35441829 CATGAGGATTTGCATTAAGATGG - Intergenic
1166544781 19:43627471-43627493 CAGGAGGACTTGAATAATGCTGG - Intronic
1166569145 19:43782741-43782763 CAGGAGGGTTTGATCTGTGTCGG - Intergenic
1168173502 19:54606901-54606923 CAGGAGTGTTTGAAAGAAGACGG + Intronic
925422203 2:3721719-3721741 TGGGAGGGATTGAATTATGGGGG + Intronic
925856836 2:8137180-8137202 CAGGAGGGTCTGAATCAGGCAGG - Intergenic
928782005 2:34834607-34834629 CATGAGGGTTTTTATCATGAAGG - Intergenic
929571187 2:43024209-43024231 CAGGAGGGTAGGACCTATGAGGG + Intergenic
929643982 2:43609301-43609323 AAGGAGGGTTTGGAATATAATGG - Intergenic
930694179 2:54394521-54394543 CAGGAGACTTACAATTATGACGG + Intergenic
933031536 2:77334411-77334433 CAGAAGTGATTGAATTATGGGGG + Intronic
936577433 2:113668205-113668227 GAGGAGGGTGTGAATTGTCAGGG + Intergenic
937346486 2:121129356-121129378 CAGGAGGGCTTGAAGAATCATGG - Intergenic
938781030 2:134585112-134585134 CAGGTGGGGTTGAAATGTGATGG - Intronic
939458430 2:142467482-142467504 CAGGAGGGTTTGACTTGTGCTGG + Intergenic
941230698 2:162908484-162908506 CAAGAAGGTTTGAATTTAGAAGG - Intergenic
941860202 2:170271470-170271492 CAGAAGTGTCTCAATTATGAAGG + Intronic
942434227 2:175953909-175953931 AAGGAGGGATCAAATTATGAAGG - Intronic
944442692 2:199758486-199758508 CAGCAGTGTATGAAGTATGAGGG - Intergenic
945555777 2:211273779-211273801 CAAGAGTGTTTCAGTTATGAGGG + Intergenic
1169384124 20:5133500-5133522 CAGAATGGTTCGTATTATGAAGG + Intronic
1170793004 20:19523225-19523247 CAGGGGGGTTTGAAATTTGAGGG + Intronic
1170879527 20:20283847-20283869 AAGAAGGATTTGAAATATGAAGG - Intronic
1172423852 20:34841739-34841761 TTGGAGGGTTTGGATTTTGAAGG + Intergenic
1173188208 20:40857283-40857305 CAGGAAGCTTACAATTATGACGG - Intergenic
1173689198 20:44946392-44946414 CAGAAGGGTTTTAATTACAAAGG + Intronic
1174134651 20:48371397-48371419 CAGGAGGCTGTGAGTTATGGTGG + Intergenic
1175390026 20:58621259-58621281 CAGGGGGGCTTGATTTTTGAGGG - Intergenic
1178047955 21:28716795-28716817 CTTGAGGGTTTTTATTATGAAGG + Intergenic
1178368610 21:32008623-32008645 GAGGAGTGTTTGAATGAAGAGGG + Intronic
1178564861 21:33674326-33674348 CAAGAGAGTTTGGATTCTGAAGG + Intronic
1179425629 21:41276086-41276108 CAGGAAGGCTTGCAGTATGATGG + Exonic
1182617626 22:31598746-31598768 CAGAAGTGTTTGAATTCTGTTGG + Intronic
1184498212 22:44855943-44855965 CAGGAAGCTTTCAATTATGACGG + Intronic
1185422799 22:50744459-50744481 GAGGAGGGTGTGAATTGTCAGGG - Intronic
949125568 3:442386-442408 GAGGAGGATTTTAATAATGAAGG - Intergenic
952567224 3:34673887-34673909 CTGGAGGGTTTATATTATGAAGG - Intergenic
953229111 3:41048095-41048117 CATGAGGGTTTTTATCATGAAGG + Intergenic
956053906 3:65278272-65278294 CAGGAGGGTGAGAAGTAGGAAGG - Intergenic
956856971 3:73284648-73284670 CAGGGGGGTTTGCTTAATGAGGG + Intergenic
957752314 3:84436898-84436920 CAGAAGGATATGAATTTTGAGGG + Intergenic
959139998 3:102474145-102474167 CTTGAGGGGTTGCATTATGAGGG - Intronic
959183292 3:103008983-103009005 CAGGAAGGTTACAATTATGATGG + Intergenic
960361672 3:116719675-116719697 CAGGGGGGTATGCATTATTATGG - Intronic
960942676 3:122944782-122944804 CAGGAGGCTGTGAATCAAGAAGG - Intronic
962575949 3:136755243-136755265 GAGAAGGGTTTGAATAAGGATGG - Intergenic
963656982 3:148065640-148065662 CAGGAGGGTTTGTCTTTAGAGGG - Intergenic
964145139 3:153451734-153451756 CAGCAGTGTATGAACTATGATGG + Intergenic
965250700 3:166341284-166341306 CAGGACGGTATGAATGAAGATGG + Intergenic
965282382 3:166770684-166770706 CAGGAAGCTTACAATTATGACGG + Intergenic
966229282 3:177633314-177633336 CATGAGGGTTTGAACTGTTATGG - Intergenic
966456808 3:180127219-180127241 AAGAAGGGTTTCAATTATTAAGG + Intergenic
969150685 4:5166388-5166410 CAGGAGGAGTTGAATTTGGAGGG - Intronic
970789235 4:19836940-19836962 CAAGAGGGATTGAATCAAGAAGG - Intergenic
972034021 4:34497618-34497640 CAGGAGGTTCTGAAATATGTAGG + Intergenic
974691323 4:65300862-65300884 CAGGAGGGGTGGAATAATGATGG - Intergenic
976071338 4:81243412-81243434 CAGGAAGCTTTCAATCATGATGG + Intergenic
976747319 4:88416371-88416393 TAGGAGCTTTTTAATTATGAAGG + Intronic
978277542 4:106969839-106969861 GAGGAAGGTTAGAATTATGAGGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978692136 4:111526376-111526398 GATGAGGGTTTTTATTATGAAGG + Intergenic
980062545 4:128147483-128147505 CTGGTGGGTTTGATTTATGAAGG + Intronic
980217048 4:129866129-129866151 TAGGAGGTTTAGAATAATGAAGG - Intergenic
980596653 4:134963201-134963223 AAGAAGTGTTTGAATTATGGGGG + Intergenic
980688235 4:136258071-136258093 CAGGAAGCTTTCAATCATGATGG - Intergenic
981287377 4:143034447-143034469 CAGGAAGCTTCAAATTATGATGG + Intergenic
982186174 4:152803006-152803028 CAGTAGGGGTTGAATTGTCAGGG + Intronic
982834573 4:160108526-160108548 CAGAGGTGATTGAATTATGAGGG - Intergenic
983073202 4:163293563-163293585 AAGGTTGGCTTGAATTATGATGG - Intergenic
983982215 4:174012283-174012305 CAGCAGGGTTTGAAGTAACAAGG + Intergenic
986626519 5:9728034-9728056 CAGGAGAGTCTGAACTCTGAAGG + Intergenic
989458188 5:41666552-41666574 CAGGAGAGTTTTAAGTAGGAGGG + Intergenic
990631403 5:57674419-57674441 CAGGAAACTTAGAATTATGATGG + Intergenic
991352757 5:65735571-65735593 GAGGAAGATTTGGATTATGATGG - Intronic
991677155 5:69099031-69099053 CAGGACTGGTTGAATTTTGATGG - Intronic
992055984 5:72990817-72990839 CAGGAGCGTTTGAAAAAGGAAGG + Exonic
994270879 5:97774962-97774984 CTTGAGGGTTTTTATTATGAAGG - Intergenic
995554495 5:113313510-113313532 AAGGAGGGTTGGAGATATGATGG + Intronic
995591467 5:113704758-113704780 CAGGAAGCTTTCAATTATGGCGG + Intergenic
996303481 5:122017565-122017587 CAGGTGGATGTGAATTTTGAGGG + Intronic
999900476 5:156081300-156081322 TGGGAGGGTTTGCATCATGAGGG - Intronic
1000601560 5:163281482-163281504 CAGGAAGTTTTCAATTATGGTGG - Intergenic
1001144400 5:169171163-169171185 GAGGAGGATTTGAATCTTGAGGG + Intronic
1002289880 5:178193195-178193217 CAGGGGTGTTTGGATCATGAGGG - Intergenic
1003946495 6:11080785-11080807 CAGGAAGCTTCCAATTATGAGGG + Intergenic
1004109409 6:12700780-12700802 GAGGAGGATTTGACTTAAGAAGG - Intergenic
1004328590 6:14700368-14700390 CAGGAGGCTTTCAATCATGGTGG - Intergenic
1005389957 6:25322980-25323002 GAGGAGGGCTAGAATTGTGATGG + Intronic
1005732997 6:28717048-28717070 CAGGGAAGTTTGAATTTTGAAGG - Intergenic
1008320460 6:50105817-50105839 AAGGAGGCATTGAAATATGAAGG + Intergenic
1009625361 6:66133783-66133805 CAGGAAGGTTACAATAATGATGG + Intergenic
1009734378 6:67657760-67657782 TATGATGGTTTTAATTATGATGG + Intergenic
1011414932 6:87108400-87108422 CAGGTAGCTTTGAACTATGAAGG - Intergenic
1011821060 6:91254676-91254698 TGGGAGGGATTGAATTATGGGGG + Intergenic
1014446123 6:121530101-121530123 CAGGAGGTTTTGAAAGAGGAAGG + Intergenic
1015014439 6:128394013-128394035 AAGGAGGGTTTGGGTAATGATGG - Intronic
1017892139 6:158647511-158647533 TAGGAGGGTTTGAATTCTCTAGG + Intergenic
1018458174 6:163971477-163971499 CAGGAAGGAGTAAATTATGAGGG + Intergenic
1021344642 7:19509829-19509851 CAGCAGGGTTTCAATTATCAAGG + Intergenic
1022312001 7:29205971-29205993 AAGGAGGGAATGAAATATGATGG - Intronic
1026777489 7:73239769-73239791 CAGGATGGCTTGAGATATGATGG - Intergenic
1027018342 7:74793141-74793163 CAGGATGGCTTGAGATATGATGG - Intergenic
1027069686 7:75152777-75152799 CAGGATGGCTTGAGATATGATGG + Intergenic
1027827225 7:83131386-83131408 CAGGTGTGTTTGATTAATGAAGG + Intronic
1030122389 7:106122744-106122766 CTGCAGGGTTAGAATTAGGAGGG - Intergenic
1031244254 7:119287876-119287898 CAGGAAGCTTTTACTTATGATGG + Intergenic
1036621856 8:10429503-10429525 CAGGAAACTTAGAATTATGATGG + Intergenic
1038472565 8:27837789-27837811 CAGGAGGGTTCGAATTGCAACGG - Exonic
1038851126 8:31277308-31277330 CAGGAGTGTTGAAATTAAGAAGG + Intergenic
1039083733 8:33759381-33759403 CAGGAAGCTTCCAATTATGATGG - Intergenic
1039268256 8:35852221-35852243 GTTGAGGGTTTGTATTATGAAGG + Intergenic
1042954666 8:74236915-74236937 AAGGAGGCTTGGAATTAGGATGG - Exonic
1043179670 8:77071349-77071371 CATGAAGGTTTTAATTTTGATGG + Intergenic
1044478378 8:92655695-92655717 CAGGAGGGTGTGGATTAAAAAGG + Intergenic
1044785906 8:95792649-95792671 CTGGAAGGTTTGTAGTATGATGG + Intergenic
1045419325 8:101998597-101998619 CATGAGGGTTGTAATCATGATGG - Intronic
1046998289 8:120548189-120548211 CAGGAAGCTTCCAATTATGATGG - Intronic
1047031346 8:120884933-120884955 CAGAAGGATGTGAATCATGAGGG - Intergenic
1047287049 8:123496327-123496349 CAGGAGGGTATGATTTATTCAGG - Intergenic
1047316527 8:123739725-123739747 CAGGAGGTGTTGAATCATGGGGG - Intergenic
1047540236 8:125757982-125758004 CAGAGGGGTTTGTATTATGTAGG + Intergenic
1050912782 9:11094488-11094510 AACGAGGGCTTGAATTAAGATGG - Intergenic
1052318866 9:27145336-27145358 CATGTGGGTTTGAAGTGTGAGGG + Intronic
1052445139 9:28552141-28552163 CAGGAGGGCTTGATTTAACAAGG - Intronic
1055747013 9:79459230-79459252 CAGAAGGGTTTGAATTAGGAAGG - Intergenic
1057332632 9:94129786-94129808 CAGGAGGTATTGGATCATGAGGG + Intergenic
1058080900 9:100700188-100700210 CAGGAGTGTTTTCTTTATGATGG + Intergenic
1061654944 9:132082280-132082302 CAGGAGGCTTTCAATTATGGGGG + Intergenic
1185956997 X:4502134-4502156 TAGGATGATTTGACTTATGATGG + Intergenic
1188341727 X:29010432-29010454 CCGGAGGGTTTTTATCATGAAGG + Intronic
1188643369 X:32534490-32534512 CAGGAAGCTTTCAATCATGATGG - Intronic
1189226328 X:39416330-39416352 CAGGAGGATTTGCATTTTAATGG + Intergenic
1190493851 X:51008531-51008553 CAGGAGGGTTTGGGTCATGGGGG - Intergenic
1190510907 X:51173499-51173521 CAGGAGGGTTTGGGTCATGGGGG + Intergenic
1192002104 X:67163410-67163432 CTTGAGGGTTTTAATCATGAAGG - Intergenic
1192359970 X:70433207-70433229 CAGGAGGTTTTGAACCATGAGGG + Exonic
1192931569 X:75811781-75811803 CAGGAAGCTTAAAATTATGATGG - Intergenic
1193540364 X:82764125-82764147 GAGGTGGGTTTTAATGATGAAGG - Intergenic
1193724942 X:85027128-85027150 CAGGAAGCTTCGAATTATGGTGG + Intronic
1193841119 X:86409600-86409622 CAGGAAGCTTTCAATCATGATGG - Intronic
1195606109 X:106807411-106807433 TAGGAGGTTTTGAGTAATGAAGG + Intronic
1195606456 X:106810863-106810885 TAGGAGGTTTTGAAAAATGAAGG + Intronic
1196010049 X:110877041-110877063 CATGATGGTTTGAATTATGCTGG - Intergenic
1196015406 X:110934500-110934522 CAGGAAGCTTTCAATCATGATGG - Intergenic
1197062369 X:122196265-122196287 CAGGACCGTTTGAAGTTTGATGG - Intergenic
1197528692 X:127594954-127594976 CAAGAGGTTTGGAATTATCAAGG - Intergenic
1197655023 X:129107581-129107603 CAGGAGGTTTTGAAGTATCTAGG - Intergenic
1198781428 X:140240456-140240478 CCTGAGGGTTTGTATTATGAAGG + Intergenic
1199220091 X:145308040-145308062 CAGGAAGCTTTCAATCATGATGG + Intergenic
1199543419 X:148982593-148982615 TAGGAGGGTTTGAAGTCAGAGGG - Intronic
1201419842 Y:13786603-13786625 CAGGGGGGTTTACATTTTGAAGG + Intergenic