ID: 1127808315

View in Genome Browser
Species Human (GRCh38)
Location 15:62541352-62541374
Sequence AAGAAATAACAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1384
Summary {0: 1, 1: 0, 2: 7, 3: 120, 4: 1256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127808315_1127808322 29 Left 1127808315 15:62541352-62541374 CCTTCCTCATTCTGTTATTTCTT 0: 1
1: 0
2: 7
3: 120
4: 1256
Right 1127808322 15:62541404-62541426 CCGGCCTGGAATTTGCCTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 119
1127808315_1127808319 15 Left 1127808315 15:62541352-62541374 CCTTCCTCATTCTGTTATTTCTT 0: 1
1: 0
2: 7
3: 120
4: 1256
Right 1127808319 15:62541390-62541412 GGCCTATTCTGTTTCCGGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1127808315_1127808318 10 Left 1127808315 15:62541352-62541374 CCTTCCTCATTCTGTTATTTCTT 0: 1
1: 0
2: 7
3: 120
4: 1256
Right 1127808318 15:62541385-62541407 TTCTTGGCCTATTCTGTTTCCGG 0: 1
1: 0
2: 1
3: 35
4: 330
1127808315_1127808317 -6 Left 1127808315 15:62541352-62541374 CCTTCCTCATTCTGTTATTTCTT 0: 1
1: 0
2: 7
3: 120
4: 1256
Right 1127808317 15:62541369-62541391 TTTCTTGCTCTCGACTTTCTTGG 0: 1
1: 0
2: 1
3: 30
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127808315 Original CRISPR AAGAAATAACAGAATGAGGA AGG (reversed) Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900946869 1:5835783-5835805 AAGAAAAAACAGAATGGGAGTGG - Intergenic
901528310 1:9837905-9837927 AAGAAAGGAAAGAAAGAGGAAGG + Intergenic
901551552 1:9998916-9998938 AGGAAATAACAGTAGCAGGAAGG - Intronic
901687958 1:10954750-10954772 AAAAAATTACAAAATGAGGTGGG - Intronic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
902298184 1:15482762-15482784 AAGAAAAAAGAAAATGCGGAGGG - Intronic
902388597 1:16089848-16089870 AAGAAAGAAAGGAAGGAGGAAGG + Intergenic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
903000336 1:20260973-20260995 AAGAAAGAACTGAGTGTGGAGGG - Intergenic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
904112821 1:28139985-28140007 AAAAAAAAAAAGAAAGAGGAAGG + Intergenic
904257472 1:29264497-29264519 AAAAAAAAAAAGAATGAGGTTGG - Intronic
904666838 1:32129149-32129171 AAGAAAGAAAAAAAAGAGGAAGG - Intronic
905110793 1:35593009-35593031 AAGAAAAGACAGAGAGAGGAGGG + Intronic
905150588 1:35923798-35923820 AAAACAAAACAGAATGAGGTGGG + Exonic
905362018 1:37427330-37427352 AAAAAAAAAAAGAAAGAGGAGGG + Intergenic
905426483 1:37889253-37889275 AATAAATAAAAGAATCAGGATGG + Intronic
905567758 1:38979408-38979430 AAGTACTTACAGAATTAGGAAGG - Intergenic
906507552 1:46391446-46391468 AAGCACTTACAGAATCAGGAAGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906655542 1:47545774-47545796 AAGAAAGAAAAGGAGGAGGAGGG - Intergenic
906740053 1:48173683-48173705 ATGAAATAATGGAATGAAGATGG - Intergenic
906767052 1:48443143-48443165 AAGTACTTACAGAATCAGGAGGG + Intronic
906964673 1:50444600-50444622 AATAAAGAACAGAGAGAGGAGGG - Intronic
907342622 1:53747793-53747815 GAGAAAACACAGGATGAGGAGGG - Intergenic
907455643 1:54573733-54573755 AAGAAATAAAAAAATGTGGCTGG + Intronic
908142504 1:61201539-61201561 AGGAAATAAGGGAAGGAGGAAGG + Intronic
908300910 1:62760353-62760375 AAGTACTTACAGAATCAGGAAGG + Intergenic
908479059 1:64519015-64519037 AATAATTAACATAATGAGGAAGG - Intronic
908481262 1:64541821-64541843 AAACAAAAACAGAATGAGGTGGG + Intronic
909087079 1:71180891-71180913 AAAAAAAAAAAGAATTAGGATGG + Intergenic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
909714281 1:78689123-78689145 AAGAAAAAAAGGCATGAGGATGG - Intergenic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910079539 1:83325234-83325256 CCCAAATTACAGAATGAGGAGGG + Intergenic
910080395 1:83334744-83334766 AAGAAATACATGTATGAGGAGGG + Intergenic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910396950 1:86803094-86803116 AAGTACTTACAGAATCAGGAAGG - Intergenic
910443171 1:87273631-87273653 AAGAAATAGCAGAACTAGGCTGG - Intergenic
910499288 1:87871070-87871092 AAGAAAGAAAAGAAGGAGGGTGG + Intergenic
910751752 1:90638645-90638667 AAGAAATAATAGAGAGAGGTCGG + Intergenic
911093441 1:94036254-94036276 AAGGAATAACAGACTGAGTTAGG - Intronic
911173101 1:94791256-94791278 AATAAATTACAGGTTGAGGAAGG - Intergenic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911254665 1:95620317-95620339 ATGAAATTACAGAAAAAGGAAGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911779595 1:101859381-101859403 AAGAAATAACAGAAAGACTGGGG + Intronic
911924054 1:103804434-103804456 AAAAAATAATAGAATGACAATGG + Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912125668 1:106534524-106534546 AAGAAACAACAGAATAACAAGGG - Intergenic
912214210 1:107589114-107589136 AAGAAAAATTAGAATAAGGATGG + Intronic
912316219 1:108669484-108669506 AAAAAATAAAATAATGAGTAGGG - Intergenic
912626308 1:111207211-111207233 ATGACATAACAGAATGAGCCTGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913229367 1:116728990-116729012 AAGAAATATCTGAATTATGAGGG + Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913647905 1:120878377-120878399 AAGAAAGAAAAGAAAAAGGAAGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914078721 1:144384458-144384480 AAGAAAGAAAAGAAAAAGGAAGG - Intergenic
914100458 1:144582044-144582066 AAGAAAGAAAAGAAAAAGGAAGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914173628 1:145253006-145253028 AAGAAAGAAAAGAAAAAGGAAGG - Intergenic
914223366 1:145700097-145700119 AAGAAATTACAGACTAAGAATGG + Intronic
914298528 1:146355603-146355625 AAGAAAGAAAAGAAAAAGGAAGG - Intergenic
914322194 1:146575972-146575994 AAGAAATAATAGAAAGAGCAAGG - Intergenic
914638102 1:149572922-149572944 AAGAAAGAAAAGAAAAAGGAAGG + Intergenic
914773949 1:150718784-150718806 AATAAATAAGAAAATGAGGCCGG - Intronic
914906918 1:151753932-151753954 AGGAAATATCATAGTGAGGAAGG + Intergenic
916386403 1:164276573-164276595 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
916386405 1:164276610-164276632 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
917227820 1:172802708-172802730 AAGTACTTACAGAATCAGGAAGG + Intergenic
917552874 1:176053851-176053873 AAAAAATAAGAGAATGAAAATGG - Intronic
917676609 1:177324633-177324655 AAGTACTTACAGAATCAGGAAGG + Intergenic
918222730 1:182450599-182450621 GAGAAATGAGAGGATGAGGAAGG + Intronic
918421024 1:184364291-184364313 AAAAGCTAACACAATGAGGATGG + Intergenic
918492604 1:185098085-185098107 AAGAAACAACAGATTGAAAATGG + Exonic
918780621 1:188695252-188695274 AATAGATAACAGACTGAGAAGGG - Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919534230 1:198766903-198766925 AAGAAATAAATGAAGGAAGAAGG + Intergenic
919619007 1:199843781-199843803 AGGAAAGAACAGAGGGAGGAAGG - Intergenic
919853718 1:201691500-201691522 AACAAACAAATGAATGAGGAAGG + Intronic
920115074 1:203614976-203614998 AAAAAAAAACAGAATAGGGATGG + Intergenic
920198331 1:204244115-204244137 AAAAAATAAAAGAAAGAGGCTGG - Intronic
920364141 1:205439301-205439323 AGGAAATAACAGATTGTAGAAGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920537712 1:206750285-206750307 ACGAAATAACAGAAAGAAGTAGG - Intergenic
921020180 1:211228046-211228068 AAGTACTTACAGAATCAGGAAGG + Intergenic
921125134 1:212170841-212170863 AAGAAATAATAGATTTAGGTAGG + Intergenic
921389395 1:214603815-214603837 AAGAAAAAAAAAAATGTGGACGG - Intronic
921424102 1:214982642-214982664 AAGAAAGAACAGAAAAAGAAAGG - Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921915347 1:220603580-220603602 AAGAAATAAATCAATGTGGATGG + Intronic
922088204 1:222370806-222370828 CAGAAATTAAAGATTGAGGAGGG + Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922494311 1:226044001-226044023 AAAAAAAAAAAGAAAGAGGAAGG - Intergenic
922862235 1:228829296-228829318 AAGGAATGATAGAATTAGGAAGG + Intergenic
922919333 1:229288268-229288290 AAGAAATAACAGTGAGTGGAAGG - Intronic
923088256 1:230718233-230718255 AAGAAAGAACAGGCTGAGAATGG - Intergenic
923116852 1:230948482-230948504 AAGAAAAAAAAAAAAGAGGAAGG - Intronic
923308572 1:232711463-232711485 AAGAAATAAGAGAATGGAGGGGG - Intergenic
923595497 1:235358195-235358217 ATGAAACAATAGAATGCGGAAGG + Intergenic
924119678 1:240783670-240783692 AAGTAATAACAGAAAGTTGATGG + Intronic
924615271 1:245607076-245607098 AAAAAAAAAAAAAATGAGGAAGG + Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063578868 10:7287395-7287417 AAGAAGTATCAGACTGTGGAGGG + Intronic
1063871994 10:10427504-10427526 AAAAAAAAAAAGAATAAGGAGGG - Intergenic
1064057874 10:12113088-12113110 AAAAAATGACAAAAGGAGGAAGG - Intronic
1064125057 10:12652220-12652242 AACAAAAAACAGAATAAAGATGG - Intronic
1064603061 10:17012716-17012738 AAGTACTTACAGAATCAGGAAGG - Intronic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1064747556 10:18492655-18492677 AAGAAAAAAGAAAATGAGTATGG + Intronic
1064803564 10:19104716-19104738 ATGATATAACAGAATAAAGAAGG + Intronic
1064835268 10:19520689-19520711 AAAAAATAAAAGAAACAGGAAGG - Intronic
1065082918 10:22144951-22144973 AAGTACTTACAGAATCAGGAAGG + Intergenic
1065129395 10:22605115-22605137 AAGAAATATACGACTGAGGAGGG + Intronic
1065344893 10:24739198-24739220 AAAAAATAACAGAATTAGCCAGG - Intergenic
1065644833 10:27823260-27823282 AAGAAATAATAGGATAAGGATGG + Intronic
1065663975 10:28038365-28038387 ATTAAATAATAGTATGAGGATGG + Intergenic
1066035584 10:31479202-31479224 AAGATATAACAGACCAAGGAAGG + Intronic
1066083247 10:31952980-31953002 ATGAAATAAAGGAGTGAGGACGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066779778 10:38931719-38931741 AAGAAAGAAAGGAAGGAGGAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067345498 10:45435225-45435247 AAAAAAGAGCTGAATGAGGATGG - Intronic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067513880 10:46920325-46920347 AAGAAATCAAAGAATGAGGCAGG + Intronic
1067648374 10:48131509-48131531 AAGAAATCAAAGAATGAGGCAGG - Intergenic
1068032278 10:51718622-51718644 AATAAATAAATAAATGAGGAAGG + Intronic
1068240908 10:54299826-54299848 AAGTACTTACAGAATCAGGAAGG + Intronic
1068299186 10:55116737-55116759 AAGAAACAGCAGAAGCAGGAAGG + Intronic
1068319734 10:55396579-55396601 AAGAAATATTAGAATGATGCAGG + Intronic
1068372599 10:56137409-56137431 CAGAAATCACACAGTGAGGAAGG - Intergenic
1068398284 10:56493550-56493572 AAGAGCTAAGAGGATGAGGAGGG - Intergenic
1068415323 10:56712946-56712968 GAGAAACAACAGAATCAGTAGGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068539837 10:58279833-58279855 AAGAAATTACACCATGAGGCTGG + Intronic
1068600403 10:58950828-58950850 AAGAAATAACAGGATGAGTCAGG + Intergenic
1068623785 10:59216537-59216559 AAGAAATAGCAGAAGTAAGAAGG - Intronic
1068691249 10:59917176-59917198 AAGAAATTACTGATTGAGGCCGG - Intergenic
1068816232 10:61317275-61317297 AATAAATCATAGAATGAGAATGG - Intergenic
1068836816 10:61564454-61564476 AAGAAAAAAAAGAAGGGGGACGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069301831 10:66917380-66917402 AAGTACTAACAGTATAAGGAAGG + Intronic
1069305683 10:66965720-66965742 AAGAAATAAAAGAAGATGGAAGG - Intronic
1069323844 10:67206521-67206543 AAGAAACTAAAGAATAAGGAGGG + Intronic
1069364722 10:67685294-67685316 AAGTACTTACAGAATCAGGAAGG - Intronic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070146359 10:73776518-73776540 AAAAAATAAAAGAATTAGCAGGG + Intronic
1070279082 10:75035831-75035853 AAGAGATGAGAGCATGAGGAAGG + Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070362074 10:75700426-75700448 AAAAAAAAAAAGAATGAGAAAGG - Intronic
1071283265 10:84122440-84122462 AAGTACTTACAGAATCAGGAAGG - Intergenic
1071420704 10:85494507-85494529 AAGAAAGGAAAGAAAGAGGAAGG - Intergenic
1071441644 10:85703403-85703425 AAAAAATAAAAGAATGTGAAAGG + Intronic
1071795382 10:88999231-88999253 AAGAAGTAACAGAAGGCAGAGGG - Intronic
1071798856 10:89035416-89035438 AAAAAATAGCAGAAGCAGGAAGG - Intergenic
1072062661 10:91830512-91830534 AAGAAATAACAGAATATAGCCGG - Intronic
1072165597 10:92809750-92809772 AAAAAAAAAAAGAAAGAGGATGG + Intergenic
1072298994 10:94040916-94040938 AATACATAAAAGAATGAGTATGG - Intronic
1072890499 10:99319516-99319538 AGAGAATAACGGAATGAGGATGG + Intergenic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1073747682 10:106488314-106488336 GATAAATAACAAATTGAGGATGG - Intergenic
1073907660 10:108302724-108302746 AAGAAAGAAAAGAGAGAGGAAGG + Intergenic
1074264692 10:111889819-111889841 AAGAAATATAAGAGGGAGGATGG - Intergenic
1074300638 10:112230561-112230583 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1074613293 10:115041337-115041359 AAGTACTTACAGAATCAGGAAGG + Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074930210 10:118117243-118117265 AAGAAATTAGAAAAGGAGGAGGG - Intergenic
1074931199 10:118127939-118127961 AAGAAGTGACAGATGGAGGAAGG - Intergenic
1074942417 10:118248384-118248406 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
1075035107 10:119058894-119058916 AAGAAATAACTTAAGCAGGAGGG + Intronic
1075039407 10:119095954-119095976 AAAAAATAACAAAATTAGCAAGG - Intergenic
1075866371 10:125724095-125724117 AAAAAAGAAGAGAATGAGAATGG + Intronic
1076558736 10:131347125-131347147 AAGGAATGAGAGAAAGAGGAAGG - Intergenic
1076939829 10:133595843-133595865 AAGAAATAACACAAGAATGATGG - Intergenic
1077576004 11:3383894-3383916 AAAAAAAAAGAAAATGAGGAGGG + Intergenic
1078404093 11:11054129-11054151 AAGAAATAAAATATTCAGGAAGG - Intergenic
1078420315 11:11206449-11206471 AAAAAATAAAAGCCTGAGGAAGG - Intergenic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1078862268 11:15260154-15260176 AACAAAAAACAGAGTGAGCAGGG - Intergenic
1079072901 11:17363563-17363585 AAGAAAAGAGAGAAAGAGGAAGG - Intronic
1079288228 11:19160040-19160062 AAGAAAGAACAGAATGTTTATGG + Intronic
1079321005 11:19451269-19451291 ATGAAAGAAGAGAATGAGGGAGG - Intronic
1079477898 11:20850459-20850481 AAAAACTAATAGAATGAGTATGG - Intronic
1079539493 11:21555216-21555238 AAGAGATAATAGGATGAAGAGGG + Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079719757 11:23794990-23795012 AAAAAATAACAGAGGAAGGAAGG + Intergenic
1079810238 11:24989609-24989631 AAGAAATGTCAGCATCAGGATGG - Intronic
1079811168 11:25001226-25001248 AAGTACTTACAGAATCAGGAAGG - Intronic
1079980643 11:27148382-27148404 AAAAGATGACAGAATGTGGAAGG + Intergenic
1080133114 11:28819589-28819611 AAGAAAGAAATGAAGGAGGAAGG + Intergenic
1080297044 11:30742181-30742203 AAGAAAGAAGAAAAGGAGGAAGG + Intergenic
1080540906 11:33263784-33263806 AACAAAAGACAGAAAGAGGAAGG - Intronic
1080865780 11:36193712-36193734 AAGGCATAAAGGAATGAGGAGGG - Intronic
1081031819 11:38094004-38094026 AAGAAAGAGCAGAATAAGAATGG + Intergenic
1081033684 11:38115715-38115737 AAGTACTTACAGAATAAGGAAGG + Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081889796 11:46531411-46531433 AAAGATTAACAGAATGAGGCTGG + Intronic
1081897311 11:46597650-46597672 AAAAAAAAAGAGGATGAGGATGG + Intergenic
1081975711 11:47233407-47233429 GAGAAATTACAGAATGCGGCCGG + Intronic
1082060716 11:47857638-47857660 AAGACAGAACCGAATGAGAAGGG - Intergenic
1082720912 11:56675364-56675386 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083351888 11:62035498-62035520 AAGAAAGAAAAGAAGAAGGAAGG - Intergenic
1084653207 11:70500966-70500988 AAGAAACAACAGAATGAGGCAGG - Intronic
1085005370 11:73083576-73083598 AAGAAATAACAAGAAAAGGAAGG + Intronic
1085054676 11:73396545-73396567 AATAAATAAGAGAAACAGGATGG - Exonic
1085232831 11:74987971-74987993 AAGAACTCACAAAATGATGAGGG - Intergenic
1085471686 11:76762607-76762629 AAGAAGTGACTGCATGAGGAGGG - Intergenic
1085623733 11:78056420-78056442 AGGGAATGACAGAAAGAGGAAGG - Intronic
1085839213 11:79991341-79991363 AAGAAATAACAAAATAAGTGTGG - Intergenic
1085896605 11:80647589-80647611 AAGACATAATAAGATGAGGACGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1086102075 11:83111127-83111149 AGGAAATAACAGAAAAAGGCTGG - Intergenic
1086317904 11:85612508-85612530 AAGTACTTACAGAATCAGGAAGG + Intronic
1086537506 11:87865787-87865809 AATATATGACAGAAAGAGGAAGG + Intergenic
1087109164 11:94444365-94444387 AAACAATAACAAAATGAGGTGGG - Intronic
1087143037 11:94785101-94785123 AAAAAATAACACAAAGAGAATGG + Intronic
1087355388 11:97086946-97086968 AAAAACTAAGAGAAAGAGGAAGG - Intergenic
1087702335 11:101449474-101449496 AAGAAACAGCAGAAGCAGGAAGG + Intergenic
1087975474 11:104540676-104540698 AATAAAGAACAAAAAGAGGAAGG + Intergenic
1088107172 11:106220408-106220430 GAGATATAACAGAATAAGGAAGG + Intergenic
1088190926 11:107227369-107227391 TAGAAATAAAAGAAGGAAGAGGG - Intergenic
1088193304 11:107250017-107250039 AACCAATAACAGACTGGGGAAGG - Intergenic
1088936237 11:114402998-114403020 AAGAGATAAGAGAATAATGAAGG - Intronic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090061742 11:123469695-123469717 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091465128 12:677512-677534 AAGAAATAACAGGCTGGGCATGG + Intergenic
1091607939 12:1972854-1972876 AAGAGAGAAAAGAAAGAGGAAGG + Intronic
1091675387 12:2485386-2485408 CAGAAATAACACACTGGGGATGG - Intronic
1092256703 12:6929817-6929839 AAAAAATAACATAATAAGGGAGG - Intronic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092763269 12:11828780-11828802 AAGAAAAAAGATAATGGGGAGGG - Intronic
1092787486 12:12040769-12040791 AAGAAATGATACAAGGAGGATGG + Intergenic
1093034067 12:14316553-14316575 AAGAAATAACAAAATTAGCTGGG - Intergenic
1093156755 12:15695676-15695698 ATGAAATAAGAAAATGAGGCAGG + Intronic
1093543797 12:20320763-20320785 AAGAGATATCAGAATTAGAAAGG + Intergenic
1093568414 12:20636023-20636045 AAGAAAGAAAAGAAAGATGAAGG + Intronic
1093604675 12:21075347-21075369 AAGAAATATTAGAATGACAAGGG - Intronic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094319500 12:29170096-29170118 AAGTACTTACAGAATCAGGAAGG - Intronic
1094396286 12:30009257-30009279 AAGAAAAAAAAAAAAGAGGAAGG + Intergenic
1094584699 12:31767408-31767430 AAAAATTAAAAGAAAGAGGAGGG + Intergenic
1094613275 12:32013947-32013969 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1094647824 12:32344141-32344163 AATAAATAAAGGAATTAGGATGG + Intronic
1095190875 12:39256668-39256690 CAGAAATACCAGAATGAAGAGGG - Intergenic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095413527 12:41949849-41949871 AAGAAATAACATAAAAAGTAAGG + Intergenic
1095443372 12:42260190-42260212 AAGAAAGAAGAGAGAGAGGAAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096099775 12:48963157-48963179 AAGAAAGAAAAGAAAGAAGAAGG + Intergenic
1096211778 12:49771729-49771751 AAAAAAAAAAAGAATGAGTATGG + Intergenic
1096357784 12:50956974-50956996 AAAAAATAACAAAATGATGATGG - Intronic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096814857 12:54195703-54195725 AAGAAAGAGAAGGATGAGGAAGG - Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096851618 12:54442379-54442401 AATAAATAAGTGAATGAGCAGGG - Intergenic
1097622516 12:61957827-61957849 AAGAAATAAGGGAAAGAGGCAGG - Intronic
1098069009 12:66651850-66651872 AAAAAATACTAGAATGAAGAAGG + Intronic
1098194238 12:67983034-67983056 AAAAAAAAACAGTATGATGAAGG - Intergenic
1098403322 12:70097267-70097289 TTGAAATAACTGAATGAGAAGGG - Intergenic
1098695515 12:73548913-73548935 AAAAAATCACAGGATGAGGGAGG - Intergenic
1098855865 12:75652735-75652757 AAGAAAGAACAGAAGGGAGATGG + Intergenic
1098860198 12:75700848-75700870 AATAAATAAAAGAATGGGGAGGG + Intergenic
1098920673 12:76299424-76299446 ACGAGATCACAGAATGAAGAGGG + Intergenic
1098980531 12:76951107-76951129 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1098997880 12:77142792-77142814 AGGAAAGAAGAGAATGAGGAGGG - Intergenic
1099080049 12:78166479-78166501 AAGAAATAACAGTATGAATTTGG + Intronic
1099207746 12:79747850-79747872 AAGAAATAAAAGAAGAAGCAAGG - Intergenic
1099576607 12:84391291-84391313 AAGTACTTACAGAATCAGGAAGG - Intergenic
1099595278 12:84655063-84655085 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1099664740 12:85613581-85613603 AGGAAATGGCAGAATCAGGAGGG - Intergenic
1099680017 12:85815041-85815063 AACAAAGATCAGAATTAGGAAGG + Intronic
1099862986 12:88243150-88243172 GAGAAAGAAAAGAAAGAGGAAGG - Intergenic
1099879055 12:88444359-88444381 AAAAAAAAAAAGGATGAGGATGG + Intergenic
1100050636 12:90444866-90444888 AAGTACTTACAGAATAAGGAAGG - Intergenic
1100576668 12:95898074-95898096 AAAAAATGAATGAATGAGGAAGG + Intronic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1100797060 12:98193438-98193460 AAGCCAAAACAGAATTAGGAAGG - Intergenic
1100806429 12:98289650-98289672 TAGAAATATTACAATGAGGAGGG + Intergenic
1100818525 12:98409001-98409023 AAGAAACAAAAGAACGAGGATGG + Intergenic
1100826178 12:98476701-98476723 AAGAAATCACAAATTGAGGCCGG + Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1100976716 12:100130254-100130276 AAGAAATAATGAAATGAGGCCGG - Intronic
1101051711 12:100870535-100870557 AAGAAAATAGAGAATCAGGATGG - Intronic
1101059968 12:100960493-100960515 TAAATATAACAGACTGAGGAGGG + Intronic
1101167313 12:102052166-102052188 AAGAAAAAACACACTGAAGAGGG + Intronic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101283604 12:103285947-103285969 AAAAAATAAATGAATGAGGCCGG + Intronic
1101325877 12:103715650-103715672 CAGAAATAACTGAACTAGGAGGG - Intronic
1101519316 12:105466934-105466956 AGGAAATAAAAGAATGTGGCAGG - Intergenic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102481343 12:113225848-113225870 AAAAAATAAAAGAATTAGGCCGG - Intronic
1102523866 12:113496954-113496976 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1102671016 12:114618970-114618992 ATTAAATAAAACAATGAGGAAGG + Intergenic
1102764716 12:115422899-115422921 AAGAAAGAAAGGAAGGAGGAAGG + Intergenic
1102775108 12:115511829-115511851 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1103168252 12:118789596-118789618 AAGAAAAAAAAGAAAGAGAAAGG - Intergenic
1103283277 12:119778540-119778562 AAGAAATAATCGACTGAGCAAGG + Intronic
1103286946 12:119810401-119810423 AAGAAGTAACAAAATGTGGCTGG + Intronic
1103367767 12:120395488-120395510 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1103698217 12:122834298-122834320 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
1103990171 12:124793704-124793726 AAAAAAAAAAAGAATGGGGATGG + Intronic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104240101 12:126980065-126980087 AAAAAATAACAGAAACAGGCCGG - Intergenic
1104377994 12:128281899-128281921 AAGAAATGAAATAATGAGGCTGG - Intronic
1104433773 12:128739348-128739370 AAAAAAGAAAAGAATGAGGGGGG + Intergenic
1106098758 13:26675293-26675315 AAGAAATAAAAGAATGTAAATGG - Intronic
1106163211 13:27218790-27218812 AAGTACTTACAGAATCAGGAGGG + Intergenic
1106173144 13:27306465-27306487 AATAACTGACAGGATGAGGAAGG - Intergenic
1106699657 13:32215728-32215750 AAGAAATAAAAAAATGAGCTAGG - Intronic
1106887929 13:34210161-34210183 AAGAAGTAATAGAATAAGAAAGG + Intergenic
1107138686 13:36974087-36974109 AAGATGTGAAAGAATGAGGAAGG + Intronic
1107193850 13:37623248-37623270 AAGAAAAAAAAAAATGAGTAAGG + Intergenic
1108022010 13:46137234-46137256 AAGAAAGAATAGAATTAGGCTGG + Intronic
1108047075 13:46393336-46393358 AAGAAATTCAAGAATGAGTAAGG - Intronic
1108254748 13:48599170-48599192 AAGAAATGAAAGAAAGAGAAAGG - Intergenic
1108296610 13:49026662-49026684 AAAAAATAACAGAATTAGCTGGG - Intronic
1108334688 13:49427526-49427548 AAGAAATAAAAGAATTAGCTGGG + Intronic
1108440251 13:50445782-50445804 AAGTAATGAAAGAATGAAGAGGG - Intronic
1108515813 13:51201507-51201529 AAGTACTTACAGAATCAGGAAGG - Intergenic
1108686009 13:52819065-52819087 AAGAAAGAAAAGAAGGAGAAGGG - Intergenic
1108786873 13:53914287-53914309 AACAAAAAACTGAAAGAGGAAGG + Intergenic
1108818317 13:54316747-54316769 AAGTACTTACAGAATCAGGAAGG + Intergenic
1109184750 13:59254573-59254595 AAGAAAACACAGAAAGAGGCAGG + Intergenic
1109192532 13:59342553-59342575 AAAAAAAAATAGAATGAGGTTGG + Intergenic
1109657916 13:65419045-65419067 AACAAAAAACAGAAAAAGGAAGG - Intergenic
1110212906 13:72993752-72993774 AAAAAAAAAAAGAATCAGGATGG + Intronic
1110212914 13:72993888-72993910 AATAACAAACAGAATGAGGGAGG + Intronic
1110413798 13:75230654-75230676 AAGAGATACCAGAAAGAGAAAGG + Intergenic
1110505711 13:76283888-76283910 AAGGTATAACAGATTGAGGCAGG - Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110575479 13:77049999-77050021 AAAAAAAAAAAGAGTGAGGATGG - Intronic
1110986085 13:81971030-81971052 AAAAAATAAAGAAATGAGGAGGG + Intergenic
1111400099 13:87722741-87722763 AATAACTTACAAAATGAGGAAGG - Intergenic
1111613602 13:90637236-90637258 AAAAAATAAAAGAATAAGTAGGG + Intergenic
1112105656 13:96236564-96236586 AATAAATAACAGAAGAAGAAAGG - Intronic
1112225374 13:97534414-97534436 AAGAAAAAAGAAAATGACGATGG + Intergenic
1112253626 13:97807313-97807335 CAGAAATGACAGAATCAGGATGG + Intergenic
1112425665 13:99297693-99297715 AAAAAAACAAAGAATGAGGATGG + Intronic
1112469736 13:99676588-99676610 AAAAAAAAAAAGAATGAAGAAGG - Intronic
1112605440 13:100900646-100900668 AAGAAATAACAAAATGACTTGGG - Intergenic
1112620729 13:101051447-101051469 AAGACAGAAAAGAATGGGGAGGG + Intergenic
1112737051 13:102431879-102431901 AAGAAATGAGAGAAGGAGGGAGG - Intergenic
1113041840 13:106111972-106111994 AAAAAAAGAAAGAATGAGGAAGG - Intergenic
1113164261 13:107420238-107420260 AAGACAAAACAAAAAGAGGAAGG + Intronic
1113172165 13:107517063-107517085 AAGAAAATAAATAATGAGGAAGG - Intronic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114691796 14:24589726-24589748 AAGAAAAAAAAGAATGGTGATGG + Intergenic
1114910891 14:27194428-27194450 AATAGATAACAGACTGAGCAGGG + Intergenic
1115101262 14:29703528-29703550 AAGAAATAACAAATTTAGAAGGG + Intronic
1115160336 14:30386919-30386941 ATGAAATAACAAAATGTGGCCGG + Intergenic
1115285087 14:31706929-31706951 AAGTACTTACAGAATCAGGAAGG - Intronic
1115466022 14:33715232-33715254 TATAAATATCAGAATGAGAAAGG - Intronic
1115476537 14:33819852-33819874 ATGAAATAACAGGACGAGCATGG - Intergenic
1115510487 14:34133031-34133053 AAGAAATAACAGAGGAGGGAAGG + Intronic
1115548211 14:34481955-34481977 AAAAAAGAACAGAATGAGTTGGG + Intergenic
1116541559 14:46107832-46107854 AAAAAAAAAAAGAATGAGGCAGG - Intergenic
1116566038 14:46445567-46445589 AAGAATTAACAGACTGATAATGG + Intergenic
1116775319 14:49173738-49173760 AAGAAAGAACACATTGAAGAGGG + Intergenic
1116785283 14:49281251-49281273 AAGAAATTAAGGAAGGAGGAGGG + Intergenic
1116903708 14:50385455-50385477 ATGAAATAAGAGAATAAAGAAGG + Intronic
1116938121 14:50763065-50763087 AATAATTAACAGATTGGGGAAGG - Intronic
1117564445 14:56978811-56978833 AAGAAATGGCAGGATGAGAATGG + Intergenic
1117654397 14:57939578-57939600 AAGAAATCTCAGAGCGAGGAAGG + Intronic
1117674535 14:58142434-58142456 AAGAAACAAAAAAAGGAGGAAGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118248787 14:64138072-64138094 AAGAAAAAACAGCATAAGGTGGG - Intronic
1118269803 14:64332370-64332392 AGTAAATAACAGAATAAAGATGG + Intronic
1118594454 14:67424947-67424969 AAGAATTAAGACAATGAGAAGGG - Intergenic
1118839970 14:69502621-69502643 AAGAAAAAGCAGGATGATGATGG + Intronic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119575941 14:75722237-75722259 AAAAAAGAACAGCATGAGGGAGG - Intronic
1119916715 14:78408931-78408953 AGAAACTAACAGAGTGAGGATGG + Intronic
1119995184 14:79245876-79245898 AAGAAAAAAGGGAAAGAGGAAGG + Intronic
1120097244 14:80402767-80402789 TACAAATTACAGAATGAGGAGGG + Intergenic
1120720540 14:87885572-87885594 CAGAAATAAGAGACTGATGATGG + Intronic
1121077035 14:91077455-91077477 AAGAAAAAACAAAAAGAGGCTGG + Intronic
1121624573 14:95374805-95374827 AAGAAAGAAAAGAAGGAGGGAGG - Intergenic
1121952186 14:98181129-98181151 AAGAAATAAATGAAGGAAGAAGG - Intergenic
1122020860 14:98836814-98836836 AAGAGAGAACGGATTGAGGATGG - Intergenic
1123886783 15:24734566-24734588 AGAGAATAAGAGAATGAGGAAGG - Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124173178 15:27396019-27396041 AAGAAATAACAAAATTAGCCAGG - Intronic
1124269272 15:28266005-28266027 AAGAAATAACACCAAGAAGAAGG - Intronic
1124359043 15:29021223-29021245 AAAAAATAAAAAAAAGAGGATGG + Intronic
1124366307 15:29073687-29073709 GAGAAATAACAATATGATGATGG - Intronic
1124446805 15:29741892-29741914 AAGACAAAACAGAATCAGCAAGG - Intronic
1124447266 15:29748553-29748575 AAAAAAAAAAAGAATTAGGAAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124549078 15:30661153-30661175 GAGAAATAACAAAATTAAGATGG - Intronic
1124690950 15:31822386-31822408 AATAAATAACAGAAACTGGAGGG - Intronic
1124703862 15:31943770-31943792 AACTAAGAACAAAATGAGGAAGG + Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125298506 15:38228987-38229009 GAGAAAGAAGAGAAAGAGGAAGG + Intergenic
1125617575 15:41029003-41029025 AACGAATAACATACTGAGGAAGG - Intronic
1126565466 15:50093254-50093276 AAAAAATAACAGAATGATTATGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127557302 15:60099978-60100000 AACAAATAACAGAAAGCAGAGGG + Intergenic
1127580093 15:60330435-60330457 AACAAGTAACAGAATAAAGAAGG + Intergenic
1127738974 15:61879325-61879347 AGGAAATGACAAAATGAGAAAGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128017599 15:64361099-64361121 AAGACATAACAGCCTTAGGAAGG + Intronic
1128829570 15:70755371-70755393 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1129285675 15:74522640-74522662 AAAAAAAAAAAGAATGAGGCTGG + Intergenic
1129384301 15:75187370-75187392 AAAAAAAAAAAAAATGAGGATGG - Intergenic
1129442285 15:75590082-75590104 AAAAAAAAAAAGAATGAGTAAGG + Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129947527 15:79552942-79552964 GAGAAATAATGGAATGAGAAGGG + Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130310248 15:82747108-82747130 AATAAATAAAAGAAAGAGGCCGG + Intergenic
1130433216 15:83869999-83870021 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
1130504632 15:84527165-84527187 AAAAAAAAAAAGAATGAGAAAGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131161985 15:90111709-90111731 AAAAAAAAAAAGAATGAGGTAGG + Intergenic
1131685878 15:94767188-94767210 AAGAAATAACTGGCCGAGGATGG + Intergenic
1131777841 15:95822000-95822022 AAGAAATAGCAGCATCTGGATGG + Intergenic
1131942302 15:97580690-97580712 AAGACCTAACAGAATCAGCAAGG - Intergenic
1132195611 15:99912541-99912563 AAGAAAGAAAAGAAAGAAGAAGG - Intergenic
1132921684 16:2399294-2399316 AAGAAAAAACAGAATAAAGCTGG - Intergenic
1133452586 16:5916371-5916393 AAGAAATAAGAGAGGGAGGAAGG - Intergenic
1133674115 16:8053777-8053799 AAGAAATATCGAAGTGAGGAAGG + Intergenic
1133812811 16:9174290-9174312 GAAAAATGACACAATGAGGATGG + Intergenic
1133982853 16:10646531-10646553 AAGGAATGACTGAATGAGGTTGG + Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134113074 16:11528045-11528067 AAAAAATACAAGAATGAGGTGGG - Intergenic
1134333843 16:13275820-13275842 ACAAAGTAACAGAATCAGGAAGG - Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134809472 16:17154986-17155008 ATGAAATACCAGAATGGGAAGGG + Intronic
1134827918 16:17299303-17299325 GGGAAATAACAGAATGAAGAGGG + Intronic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135061915 16:19278347-19278369 AACAAATAAAAGAATGTGGTAGG + Intergenic
1135339149 16:21631439-21631461 AAGTACTTACAGAATCAGGAAGG - Intronic
1135746978 16:25025696-25025718 AAGAATTTAAAGAATGAGGCTGG - Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136467551 16:30455432-30455454 AAGAAAGAAAAGAATGACCATGG - Intergenic
1136636448 16:31527198-31527220 AAGAAAAAAAAGAATGGAGATGG - Intergenic
1136640273 16:31558250-31558272 TAGAAATAACATAATCAAGAAGG + Intergenic
1136994435 16:35179682-35179704 AAGAAATGAGGGAATGAGGAGGG - Intergenic
1137300729 16:47144832-47144854 AACAAATAAATAAATGAGGAAGG - Intergenic
1137443441 16:48515856-48515878 AAGGCATTACAGAATGAGGGAGG + Intergenic
1137472882 16:48777335-48777357 AAGAAATGACACATTGAAGATGG - Intergenic
1137873952 16:51977471-51977493 AAGAATGAACAGAATGGTGATGG - Intergenic
1137901236 16:52271564-52271586 ATGACATCACAGAAGGAGGATGG + Intergenic
1137972933 16:53003494-53003516 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1138974012 16:62181588-62181610 TAGAACTAACATATTGAGGAAGG - Intergenic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139097784 16:63726795-63726817 AAGAAAAAAGAGAAAGAGAAAGG - Intergenic
1139289917 16:65848471-65848493 AAGATTTAACAGAAAGAAGAAGG + Intergenic
1139480784 16:67229568-67229590 AGGAGATGACAGAGTGAGGAGGG - Exonic
1139481361 16:67232531-67232553 AAAAAAAAAAAGACTGAGGAAGG + Intronic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1139627631 16:68203469-68203491 AAAAAATACCAGAATTAGGCCGG + Intronic
1139744979 16:69067055-69067077 AAGAAATAATAGAATTAGTCGGG - Intronic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1140011431 16:71135194-71135216 AAGAAATAATAGAAAGAGCAAGG + Intronic
1140489367 16:75321533-75321555 AAACAATAACAGAATAAGGCAGG - Intronic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1140837790 16:78811488-78811510 AAGAAAGAAAAGAAAGAGGGAGG - Intronic
1140898170 16:79343842-79343864 AAGAAAAAACAGAGTGTGCAGGG - Intergenic
1141348461 16:83270850-83270872 AGGAAAGAAGAGAGTGAGGAAGG - Intronic
1141401923 16:83755619-83755641 TAGAAATAATGGAATGTGGAAGG + Intronic
1141566018 16:84902618-84902640 AAGAAACAACAAAATTTGGATGG + Intronic
1141864266 16:86739358-86739380 AAGAAAGAAGAGAGAGAGGAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141952401 16:87347395-87347417 AAGATGTATCAGAATGAGGCCGG + Intronic
1142498273 17:317936-317958 AAGAAACAACAGAGGGTGGAGGG - Intronic
1143425853 17:6836970-6836992 AAGCTACAAAAGAATGAGGAAGG + Intergenic
1143549567 17:7621731-7621753 GAGAAATTACAGAAGGAGGCTGG + Intronic
1144096459 17:11904647-11904669 AAAAAAAAAAAGAATGGGGAAGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144996248 17:19271203-19271225 AAGAAATGTCAGATAGAGGAGGG + Intronic
1144997019 17:19277102-19277124 TAGAAATAACAGAATGTGCCCGG + Intronic
1145709087 17:26952410-26952432 AAGAAAGAAAGGAAGGAGGAAGG + Intergenic
1146154072 17:30505236-30505258 AAGAAATAATAGAGAGAGGCCGG + Intronic
1146446662 17:32937575-32937597 AATAAATAAAATAATGGGGAAGG - Intronic
1146932422 17:36786873-36786895 AAGAAAGAAAAGAGAGAGGAGGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147341864 17:39757138-39757160 AAGAGAGAACACAATGATGATGG + Intergenic
1147492187 17:40879987-40880009 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148298024 17:46519953-46519975 ATGAAATAACAGAATTTGGTGGG + Intronic
1148384725 17:47226022-47226044 AAGAAAGAAGAGAGGGAGGAGGG - Intergenic
1148453475 17:47797053-47797075 AAGAAATAACAAACTCAGGCCGG - Intergenic
1149014107 17:51888218-51888240 AGGAAGTAACAAAAGGAGGAAGG + Intronic
1149246685 17:54716913-54716935 AAGAAATAATAGAACAAGGTTGG - Intergenic
1149355537 17:55835426-55835448 TAGAAATCAGAAAATGAGGAAGG - Intronic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149546102 17:57504991-57505013 AAGAAATAATAGAATGGGATGGG + Intronic
1149676251 17:58465157-58465179 AAGAAATAAAGGAAGGAAGAAGG - Intronic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1149956777 17:61059998-61060020 AAGAAAGAAGGGAGTGAGGAAGG + Intronic
1149969514 17:61202479-61202501 AAAAAAAAAGAAAATGAGGAGGG - Intronic
1150021936 17:61625597-61625619 AACAAATAGCAGAAAGAGAAAGG - Intergenic
1150023290 17:61643659-61643681 AAAATAGAACAGAGTGAGGAAGG + Intergenic
1150187019 17:63193177-63193199 CAGAAATAAGAGAATCAGTAGGG - Intronic
1150557077 17:66263882-66263904 AAGAAAGAAAAGAAAAAGGAAGG + Intergenic
1150966005 17:69969543-69969565 AAGAAATAACATCTTGAGTAAGG - Intergenic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151184917 17:72356748-72356770 AAAAAAAAAAAGAATGGGGAGGG + Intergenic
1151228233 17:72662444-72662466 AAGAAAAAAAAGAAAAAGGAAGG + Intronic
1151374461 17:73676349-73676371 ATCACATAACAGAATGATGAAGG + Intergenic
1151617311 17:75221945-75221967 AAGAAATAGAAGAATGTGGGAGG + Intronic
1151918444 17:77136239-77136261 AAGAAAGAAAGGAAAGAGGAAGG - Intronic
1152310428 17:79546656-79546678 AAAAAAAAATAGAATGAGGAAGG - Intergenic
1153492980 18:5669149-5669171 AGGAAATGAGAGAAGGAGGAAGG + Intergenic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1153645884 18:7195695-7195717 AAGAAATCTCAGAGTGAGGGGGG - Intergenic
1153663075 18:7342928-7342950 TAGAAATAACAAAATGTGGCTGG + Intergenic
1154179494 18:12119876-12119898 AAAAAATAACATATTGAGGTTGG - Intronic
1155227272 18:23739568-23739590 AAGATGTAACAGAAGGAGAAGGG + Intronic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156696330 18:39772734-39772756 AAGATACAATAGATTGAGGAAGG + Intergenic
1156746836 18:40402630-40402652 GAAAAAGAACAGAAGGAGGAGGG + Intergenic
1156748308 18:40419244-40419266 AAAAAAAAAAAGAATGTGGATGG - Intergenic
1156838896 18:41588140-41588162 AAGAAACAACACAATTAGGCTGG - Intergenic
1157180661 18:45495190-45495212 AAGAAAAGACAGACAGAGGAAGG + Intronic
1157637223 18:49170483-49170505 AAGAAAGAACTGTATGAGGTCGG + Intronic
1157673289 18:49548995-49549017 TAAAAAGATCAGAATGAGGAGGG + Intergenic
1157722616 18:49937043-49937065 AGGAACTAACAGAGGGAGGAGGG - Intronic
1158258729 18:55585536-55585558 AAGAAAGAACAGAGTGATAATGG - Intronic
1158611100 18:58941849-58941871 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159438491 18:68447796-68447818 AAGAGCTATCAGAATCAGGAAGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159679411 18:71328707-71328729 AAGAAAGAACAGGATGAAAATGG - Intergenic
1159737338 18:72115769-72115791 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1159737344 18:72115804-72115826 AAGGAAGGAAAGAATGAGGAAGG - Intergenic
1159754323 18:72345177-72345199 AATAAATGGCAGAATGAGGAAGG + Intergenic
1160035427 18:75297150-75297172 AAAAAATCACAGAAAGAGCATGG + Intergenic
1160060091 18:75521914-75521936 AAGAAATAATTGCAGGAGGAAGG - Intergenic
1160135266 18:76266215-76266237 AAGAAAGAAAAGAAAAAGGAGGG + Intergenic
1160607813 18:80065744-80065766 GACAAAGAACAGGATGAGGAGGG - Intronic
1161597717 19:5159794-5159816 AAGTACTTACAGAATCAGGAAGG - Intronic
1161616465 19:5273600-5273622 AAAAAAGAACAGAGTGAGGCTGG + Intronic
1161753955 19:6117783-6117805 AAGAAAGAAAAGAAAAAGGAAGG + Intronic
1162219935 19:9167792-9167814 ATGAAATAACAGGAGGTGGAGGG - Intergenic
1162404459 19:10465215-10465237 AAAAAAAAAAAAAATGAGGAGGG - Intronic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1162839235 19:13343418-13343440 AAGAAAGACCAGAAGGAGGCTGG - Intronic
1162998981 19:14354117-14354139 AAGAAAGAAGAGAGTGAGCAAGG + Intergenic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164204025 19:23043054-23043076 AAGAAATGGAAGAATTAGGATGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1164456590 19:28412548-28412570 AAGAAATGACAGAGTCAGAAGGG + Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164861278 19:31564117-31564139 AAAAAAAAAAAAAATGAGGACGG - Intergenic
1164957812 19:32402231-32402253 AAGAAAGAAGAGAAAGAGAAGGG + Intergenic
1164970157 19:32525063-32525085 AAGAAACAAGAGATTGAGGCTGG + Intergenic
1164992537 19:32694785-32694807 AAGTACTTACAGAATCAGGAAGG - Intronic
1165460956 19:35944206-35944228 AAGAAAGAAAAGAAACAGGATGG + Intronic
1165716014 19:38046361-38046383 AAGAAATAGGGAAATGAGGAGGG - Intronic
1165729157 19:38133331-38133353 AAGGAATGACAGAATGAAGATGG - Intronic
1165995659 19:39841852-39841874 AAGAAATAACAGACTCAGACAGG + Intronic
1166237856 19:41469466-41469488 AAGAAATAATATTATGGGGAGGG + Intergenic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1166314952 19:41984518-41984540 AAAAAATAAAATAATGAGGCTGG - Intronic
1166691658 19:44825183-44825205 ATGAAATATCAGAAAGAGGCAGG + Intergenic
1166928839 19:46288823-46288845 AAGAAATGAAGGAAGGAGGAAGG + Intergenic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167191220 19:47991522-47991544 AAGAAAGAAGAAAAGGAGGAGGG - Intronic
1167253272 19:48412833-48412855 AAAAAAAAAAAGAAAGAGGAGGG + Intronic
1167530345 19:50011960-50011982 AAAAAAAAAAAGAATGAGCAAGG - Intronic
1167674527 19:50876114-50876136 GAGAAAGAACAGAACCAGGAAGG - Intronic
1167684130 19:50944951-50944973 AAGAAAGAAAAGAGAGAGGAAGG - Intronic
1167791228 19:51683533-51683555 AAGAAAAAAATAAATGAGGATGG + Intergenic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
1168082111 19:54017721-54017743 AAGAAGTAAAAGGAGGAGGAGGG - Intergenic
1168330470 19:55564821-55564843 AAGAAATACGAGGATGAGGCCGG + Intergenic
1168383307 19:55942466-55942488 AGGAAATAACAGCAGGAGAAGGG - Intergenic
1168469700 19:56630222-56630244 AAAAAATCTCAGAAAGAGGAGGG + Intergenic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
1168633431 19:57975250-57975272 AAGAAAGAAAAGAAAGTGGAAGG + Intergenic
1202674214 1_KI270710v1_random:26071-26093 AATAAAAAAAAGAATGAGGTTGG + Intergenic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
925954881 2:8954082-8954104 AAGAAATAACATTATAGGGAAGG - Intronic
926832787 2:16981632-16981654 AGCAAAGAAAAGAATGAGGAAGG + Intergenic
927271942 2:21220501-21220523 AAGAAATCTCAGAATGAGAAAGG - Intergenic
927493766 2:23538397-23538419 AAGATAAAACAGAATAAGAATGG - Intronic
927570575 2:24155841-24155863 AAGAAATAAAAATATGAGCATGG - Intronic
927693733 2:25226255-25226277 AAAAAATAAAAAAAAGAGGAAGG - Intergenic
927842391 2:26453977-26453999 AGGAAATGACAGCATGGGGAAGG + Intronic
928553173 2:32394671-32394693 AAAAAATAACAGAATTAGCTGGG + Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930181197 2:48359582-48359604 AAGAAAAAACAGGCCGAGGATGG - Intronic
930544529 2:52749738-52749760 CAGAAATAAAAGAAAAAGGAAGG - Intergenic
931115168 2:59158331-59158353 AAGAAACAAAAGAAAGAGGAAGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931181049 2:59901097-59901119 AACAAAAAACATAATTAGGAAGG - Intergenic
931196563 2:60057606-60057628 ATGAAATAATAGCATGAGCAAGG + Intergenic
931222771 2:60303155-60303177 ACCAAATAGCAGAATGTGGAGGG + Intergenic
931526827 2:63165805-63165827 AAGAAATGGCAGAGGGAGGAAGG - Intronic
931540822 2:63327265-63327287 AAGTACTTACAGAATCAGGAAGG + Intronic
931601071 2:64003659-64003681 AAGTAATAACAGAATGGGTCTGG + Intronic
931735652 2:65191034-65191056 AAGAAAAGACATATTGAGGAGGG + Intergenic
931812894 2:65872363-65872385 GAGAAATAGCAGAGTAAGGAAGG + Intergenic
931852724 2:66269090-66269112 AAAAAATGACAGAAGGAAGAAGG + Intergenic
932170215 2:69548545-69548567 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
932269950 2:70400447-70400469 AAGAAGTAAATGAATGAGCATGG + Intergenic
932840830 2:75080949-75080971 TAGAAAAGACAGAATGAGAATGG + Intronic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933068815 2:77833098-77833120 AAGAAATACCAGAATGAACAGGG - Intergenic
933114320 2:78447391-78447413 AAGAAAAGACACATTGAGGAGGG - Intergenic
933144624 2:78836500-78836522 CAGAAATAGCACAGTGAGGATGG - Intergenic
933150745 2:78911937-78911959 AAGAGATAAAAGAAAAAGGAAGG + Intergenic
933309042 2:80637748-80637770 GAGAAGTGAAAGAATGAGGAAGG + Intronic
933855698 2:86412150-86412172 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
933892462 2:86784375-86784397 AAGAAAGAACAAAAGGAAGAAGG + Intergenic
934042588 2:88141010-88141032 AAGAAAGAAAAGAGGGAGGAGGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935013914 2:99161352-99161374 ATGAAATAATAGTATGGGGAGGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935153553 2:100461859-100461881 AAGAAAGAAGGGAATAAGGAAGG - Intergenic
935377868 2:102418901-102418923 AAGACATAAAAAAAAGAGGAAGG - Exonic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
935486825 2:103666595-103666617 AAGAAATATCAGAAAACGGATGG + Intergenic
935952220 2:108340394-108340416 AAGAAACAACAGAAAGTGCAAGG - Intergenic
935957532 2:108392513-108392535 AAGAGACAACAGAAAGAGAAAGG + Intergenic
936106588 2:109630263-109630285 AAGAAATAACAGGCTCAGGTTGG + Intergenic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
936707443 2:115091113-115091135 TGGATATAAGAGAATGAGGAGGG - Intronic
936848054 2:116861616-116861638 ATGAAATAAGAAAATGAGGAAGG - Intergenic
936891392 2:117373922-117373944 AAGAAAAACCACCATGAGGAGGG + Intergenic
937042208 2:118831443-118831465 AAGAAACACAAGGATGAGGAGGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937549791 2:123073680-123073702 TAGAAATAACAGAAGGAGCCAGG - Intergenic
937564422 2:123266741-123266763 AAGAAATAACAAATTTGGGAAGG - Intergenic
937603467 2:123768479-123768501 AAGAAATAAAGGAAAAAGGAAGG - Intergenic
937998722 2:127715060-127715082 AAGAAAGAAAAGAAAGAAGAGGG - Intronic
938452787 2:131437562-131437584 AAGTAATAAAAGGATGAGGTCGG + Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
938864138 2:135400799-135400821 AACAAATAAATGAATGAGCAGGG + Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939785533 2:146506506-146506528 AAGAAATACTAGCATGAGGCAGG - Intergenic
940097408 2:149993294-149993316 AGGAAATAGCAGAAGCAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940492218 2:154377391-154377413 AAGAAAGAAAAGAAAGAGGATGG + Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941232990 2:162934346-162934368 AACAAATAAGAGGATGGGGAGGG - Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941747039 2:169097896-169097918 AAGAAAGAACACAATCAGGTAGG - Intergenic
941980707 2:171453461-171453483 ATGAAATTACAAAATGAGTAAGG + Intronic
942101895 2:172591848-172591870 AAGTACTTACAGAATCAGGAAGG - Intronic
942868423 2:180705071-180705093 CAGAAATAAAAGAGTGAGGAAGG + Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943190571 2:184673101-184673123 ATGAAATAAAAGAAGGAGGAAGG + Intronic
943337778 2:186639658-186639680 ATGCAATAACAGATTGAGCATGG - Intronic
943338397 2:186646608-186646630 AAGAAAGGGAAGAATGAGGAAGG - Intronic
943350490 2:186791472-186791494 AAAAAAAAAAAGAATGAGAAAGG + Intergenic
943561794 2:189472920-189472942 AAGAAATATCATAAGGAGGCCGG + Intronic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
943902264 2:193455414-193455436 AAGTACTTACAGAATCAGGAAGG + Intergenic
944061722 2:195576244-195576266 TAGAAATGACTGGATGAGGAGGG - Intronic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944474993 2:200094419-200094441 AAGAAATCAGAGAAAGAGGGAGG + Intergenic
944486601 2:200213357-200213379 AAGAAAGAAAGGAAAGAGGAAGG - Intergenic
945157670 2:206856592-206856614 AAGAAATAAAATAAGAAGGAAGG - Intergenic
945372079 2:209031360-209031382 AAGGAATAAAACAATGAGGCTGG + Intergenic
945531482 2:210959037-210959059 AGGAAATAACAGGATGAAGATGG - Intergenic
945914848 2:215692622-215692644 AAGAAATATTTGAATGAAGAAGG - Intergenic
945932773 2:215872272-215872294 AAGCAATACCAGAATTAGTAAGG + Intergenic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
947045979 2:225984921-225984943 AAGACATAACATTATTAGGAGGG + Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947653411 2:231806622-231806644 AAGAAACAGCAGGAAGAGGATGG - Intronic
947681566 2:232038306-232038328 AAGAAAGAACAGAAAGATGGTGG + Intronic
947942733 2:234072686-234072708 CTGAAATCACAGAATGAGGCTGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948181384 2:235983511-235983533 AAGAAAAAAGAGAATAAGAAAGG - Intronic
948238482 2:236408648-236408670 AAGAAATGGCAGAATATGGATGG - Intronic
948791954 2:240383734-240383756 AAGAAAGAACAAAAGGAAGATGG - Intergenic
948917410 2:241041713-241041735 AAGAAACAACAGACTGACGGTGG + Intronic
949063802 2:241976911-241976933 AAGGAAGAACAGAAAAAGGATGG - Intergenic
1168826994 20:820449-820471 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1168837527 20:887872-887894 GATAAATAAAAGAAGGAGGAAGG + Intronic
1169016582 20:2297610-2297632 AAGTCACAACAGAATGAGGCTGG + Intronic
1169050486 20:2572791-2572813 AAGAATTAAGTGAATGAGAATGG - Intronic
1169625119 20:7557995-7558017 AATAGATAACAGAATGGGAAGGG - Intergenic
1169993514 20:11529816-11529838 AAAGAACAACAGAATTAGGAAGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170101498 20:12705408-12705430 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1170280256 20:14638652-14638674 AAGAATTAACTGAGTGAGGCTGG + Intronic
1170318497 20:15068535-15068557 ATGAACTAACACTATGAGGAGGG - Intronic
1170371127 20:15649136-15649158 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1170404114 20:16018594-16018616 AAGACAGAAGAGGATGAGGAGGG - Intronic
1170629041 20:18052740-18052762 AAGAAAGAACAGAATAGGAAAGG + Intronic
1171007215 20:21478333-21478355 AAACAATAACAATATGAGGAAGG + Intergenic
1171174682 20:23042645-23042667 AAAAAAAAAAAAAATGAGGAAGG + Intergenic
1171202117 20:23250603-23250625 AAGAAATAACAGGCTGGGGGTGG - Intergenic
1171261853 20:23741095-23741117 AAGTACTTACAGAATCAGGAAGG + Intergenic
1171270988 20:23816975-23816997 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172014870 20:31867341-31867363 TGGAAAGAACAGAATGAGCAAGG - Intronic
1172340910 20:34156737-34156759 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172395874 20:34604705-34604727 AAGAAATAACTGATTGAGTTTGG + Intronic
1172549076 20:35784888-35784910 AAAAAATACAAAAATGAGGAAGG + Intronic
1173117785 20:40262715-40262737 AATAAATAGCAAAATGAGTAGGG + Intergenic
1173343624 20:42177869-42177891 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1173772793 20:45678005-45678027 GAGAAAAAAAAGAATGAAGAAGG - Intergenic
1174015015 20:47480895-47480917 AAGAAAGGAAAGAAGGAGGAAGG - Intergenic
1174089859 20:48038195-48038217 AAGAAATAGCAGAGTCAGGCGGG + Intergenic
1174126436 20:48310373-48310395 AAGAAATAGCAGAGTCAGGCGGG - Intergenic
1174289511 20:49497773-49497795 AAGAACTAATAGAAAGAGAATGG - Intergenic
1174310318 20:49648256-49648278 AAGAAAGAAGAGAAAGAGGCTGG + Intronic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1174551359 20:51364523-51364545 AAGAAATCTAAGAAAGAGGATGG + Intergenic
1174763531 20:53229972-53229994 GAGAAAGAAAAGAAAGAGGAAGG + Intronic
1175035828 20:56000969-56000991 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1175098156 20:56558496-56558518 AAAAAAAAAAAGAATGAGTAGGG - Intergenic
1175559797 20:59912762-59912784 AGGAGATAACAGAATCATGAGGG + Intronic
1175633055 20:60558125-60558147 AAAAAATAAAGGAAGGAGGAAGG - Intergenic
1177234739 21:18373911-18373933 CAGAGATAAAAGAATGAGTAAGG + Intronic
1177301800 21:19256232-19256254 AAGAAATAAAGGAAAGATGAAGG + Intergenic
1177374825 21:20256027-20256049 AAGGAATAACAGAATAACGGCGG + Intergenic
1177406865 21:20680424-20680446 AAAAAATAAAAGAAAGAGAAAGG + Intergenic
1177963259 21:27695405-27695427 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1178146847 21:29750257-29750279 AAGGAATAAAGGAATGAGGGAGG - Intronic
1178184957 21:30208617-30208639 AAGAAAGAAAAGAAGGAGGCAGG + Intergenic
1178276988 21:31247896-31247918 AAGAAATAACAAAAATGGGAGGG + Intronic
1178457266 21:32766954-32766976 AAGAGATAAAAGAATCAGGAAGG - Intronic
1178836958 21:36106471-36106493 AAGTACTTACAGAATCAGGAAGG + Intergenic
1178845330 21:36169756-36169778 AAGAAATGGCAGGATGAGGATGG - Intronic
1179416866 21:41205575-41205597 AAGACACAACAGAAGTAGGAAGG - Intronic
1179495752 21:41770258-41770280 AGAAAATAACACAATGCGGAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181461256 22:23087173-23087195 AAGAGATGATAGAATGAGCATGG + Intronic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1181968303 22:26671833-26671855 AAAAAAAAAAAGTATGAGGATGG + Intergenic
1182262121 22:29080914-29080936 AAAAAATAATACAATCAGGACGG - Intronic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1182721747 22:32407720-32407742 AAGAAATAATTGAATCTGGATGG - Intronic
1182944033 22:34305459-34305481 AAGGAATAAAAGAATGGGGCCGG - Intergenic
1183041153 22:35178968-35178990 AAGAAATAGTAAAAGGAGGAAGG - Intergenic
1183208349 22:36434530-36434552 AAGAAATGAGTGAATGAGGCCGG - Intergenic
1183312983 22:37121469-37121491 AAGAAATAATTGAATGTGGCAGG - Intergenic
1183679107 22:39316782-39316804 AAGAAATGGCAGGATGAGGATGG - Exonic
1183973668 22:41497363-41497385 AAGAAATGACAGCAAGAGGCCGG - Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184177400 22:42796005-42796027 AAGAAAAAAAAAAAAGAGGAAGG - Intergenic
949098545 3:115180-115202 AAAAATTAACAGTATGATGAAGG + Intergenic
949119084 3:363773-363795 GAGGCATGACAGAATGAGGAGGG + Intronic
949134576 3:548282-548304 AAGGAATTAAAGAAAGAGGAAGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949339719 3:3016316-3016338 AAGTAATAACAGAAGAGGGAAGG - Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
949508058 3:4745053-4745075 AAGAAAACACAGAAAGAGAAAGG - Intronic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949739389 3:7213043-7213065 AAAATAGAACAGAATCAGGATGG - Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950044656 3:9941803-9941825 AAAAAAAAAAAAAATGAGGAAGG + Intronic
950237601 3:11337086-11337108 AAGAAAAAACAGAGTTAAGATGG - Intronic
950354967 3:12399606-12399628 AAGAAAGAAAAGAAAGAGAAAGG + Intronic
950571802 3:13805131-13805153 ATGCATTAACTGAATGAGGATGG + Intergenic
950722057 3:14890452-14890474 AATGAATAAAGGAATGAGGACGG + Intronic
950936192 3:16842078-16842100 AAAAAATATCACAATGAGGTTGG + Intronic
951185737 3:19710781-19710803 AAGAAATAATAGTGTGATGAAGG + Intergenic
951218264 3:20043888-20043910 GAGAGATTAGAGAATGAGGAGGG + Intronic
951347817 3:21567373-21567395 AAATAATAAAAGATTGAGGAAGG - Intronic
951437503 3:22681624-22681646 AACAAATAAATGAAAGAGGAAGG + Intergenic
951534185 3:23726531-23726553 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
951825748 3:26866241-26866263 AAGAAATAAGAGTATTAAGAGGG + Intergenic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952238854 3:31509184-31509206 AAGAAATAAAAGAAGGAAGGAGG + Intergenic
952433298 3:33247129-33247151 AAGAAAGAAAAGAAAGAGGAAGG - Intergenic
952554813 3:34520062-34520084 AAGTACTTACAGAATCAGGAAGG - Intergenic
952579296 3:34812307-34812329 AAGAAATAAATTGATGAGGAAGG + Intergenic
952602322 3:35100379-35100401 AAGCAATAAGAGAAAGAGGCTGG + Intergenic
952623160 3:35370070-35370092 AAGACATTACTTAATGAGGAAGG + Intergenic
952681783 3:36101837-36101859 AATAAATAATTAAATGAGGAAGG - Intergenic
952709873 3:36419253-36419275 AACAAATAAGAGAATTAGGAAGG - Intronic
952846271 3:37690420-37690442 AAAACAAAACAGAATGAGGTGGG - Intronic
952909578 3:38170935-38170957 AAAAAATAAAACAATGAGGCGGG - Intronic
953303908 3:41808196-41808218 AAGAAATAAGACAAAGAGCAAGG - Intronic
953311223 3:41881545-41881567 GAGAAATAACAAAATTAAGATGG + Intronic
953500807 3:43431975-43431997 AAGAAATGAGAGAATCAGTAAGG - Intronic
953715233 3:45311748-45311770 AACAAATGACAGAAAGAGAACGG - Intergenic
953976350 3:47384498-47384520 TAGAAATACCAGCCTGAGGAGGG + Intronic
954102540 3:48387047-48387069 AAGAAATAACACCCTGAGGCAGG - Intronic
954599288 3:51855293-51855315 AAGAACTTACAGAATCAGGAAGG + Intergenic
954604582 3:51898946-51898968 AAGTACTTACAGAATCAGGAAGG + Intronic
954774460 3:53004229-53004251 AAGAAAGAAGGGAAGGAGGAAGG - Intronic
954907672 3:54076708-54076730 AAAAAAAAACAGAGAGAGGAAGG - Intergenic
955072963 3:55587146-55587168 AAGAAAGAAAAGAAAAAGGAAGG - Intronic
955123940 3:56090795-56090817 TAGAAATAAAAAAAAGAGGAAGG - Intronic
955141850 3:56277526-56277548 AAGAACCTAAAGAATGAGGAGGG - Intronic
955289413 3:57677118-57677140 AAAAAATAACAGTTTGAGGCTGG - Intronic
955774907 3:62422485-62422507 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
955972737 3:64451932-64451954 AAGGAATAAAAGAATGGGCAAGG + Intergenic
956312788 3:67900264-67900286 GATAAATAAGAGGATGAGGAGGG + Intergenic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958695057 3:97516899-97516921 ATGAAATAAATGAATGAGGGGGG - Intronic
958701412 3:97595733-97595755 ACGAAATAAGAGAATGGGGAAGG + Intronic
959108577 3:102094528-102094550 AGGAAATCATAGAATGAGTAGGG + Intergenic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959243968 3:103839064-103839086 AAGAAATTATAGAAAGAAGACGG + Intergenic
959263679 3:104112412-104112434 AGGGAATCACAGAGTGAGGATGG + Intergenic
959581401 3:107986619-107986641 AAGAAAAAACAGTAAGAGGCTGG + Intergenic
959802672 3:110513433-110513455 AAGAAATAAAAGAGTAAGAATGG - Intergenic
960063972 3:113351127-113351149 AAGTACTTACAGAATCAGGAAGG + Intronic
960322564 3:116254397-116254419 AAAAAATTAAAGAAAGAGGAGGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960461149 3:117937506-117937528 GAGAAATAAGATCATGAGGATGG + Intergenic
960755529 3:121007628-121007650 AGGAGATAACAGGATGAGGGTGG + Intronic
960758014 3:121039740-121039762 AATAAAAAAGAGAAAGAGGAGGG - Intronic
960923907 3:122778492-122778514 AAGAAATACTAGACTGTGGATGG - Intronic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961775404 3:129280383-129280405 AAAAAATAAAAAAATGAGGTGGG + Intronic
961781381 3:129322663-129322685 TAAAAGTAACAGAATGAGGCCGG + Intergenic
962050340 3:131806991-131807013 AAGAGATAAGAGAAAGAGAAAGG + Intronic
962156321 3:132952449-132952471 AAGAAATATCAGAAAGAGCCTGG - Intergenic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962347633 3:134630234-134630256 GAGAAATAACAGAATAAAGTGGG - Intronic
962644456 3:137422235-137422257 AAGAAGTAAGAGAATCAGAAAGG + Intergenic
962763202 3:138537014-138537036 AAAAAAGAACAGGATGAGCAGGG + Intronic
962932862 3:140053655-140053677 CAGAAATAAGAGAGAGAGGAGGG - Intronic
963060835 3:141223932-141223954 AAGAAATATAAGAATGACAATGG + Intergenic
963198764 3:142565556-142565578 AATAAGTAAAAGAATGAGCATGG + Intronic
963431898 3:145217365-145217387 AACAAATTACAGACTGAGGTAGG - Intergenic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963639718 3:147843676-147843698 AAGAAATAACAGCATAAAAATGG + Intergenic
963697228 3:148576800-148576822 AAGTACTTACAGAATCAGGAAGG + Intergenic
963781178 3:149487960-149487982 GAGAAATAACTAAAAGAGGACGG + Intronic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
963931080 3:151004877-151004899 AAGAAAAGACAGAAAGAAGAGGG - Intergenic
963971973 3:151440188-151440210 AAAAAATAAAAAAATTAGGAGGG - Intronic
963991808 3:151664892-151664914 AAGTACTTACAGAATCAGGAAGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
964486403 3:157189374-157189396 AAGAAAGAACAAAAGAAGGAAGG + Intergenic
964972487 3:162578813-162578835 AAGTACTCACAGAATCAGGAAGG + Intergenic
964998018 3:162911769-162911791 AAGATAGTACAGAATGAGAATGG - Intergenic
965061849 3:163793963-163793985 AGGAAAGAACAGAATGGGGGAGG - Intergenic
965139697 3:164817508-164817530 AAGTACTTACAGAATCAGGAAGG + Intergenic
965258134 3:166443462-166443484 AAGCAATAACACAATCAGAAGGG + Intergenic
965477576 3:169176319-169176341 ATGAAATATAAGAATGAGGTAGG + Intronic
965498933 3:169433543-169433565 AAGAAAAGAAAGAAAGAGGAAGG + Intronic
965749429 3:171960812-171960834 AAGAAAGAAAAGAAAGAGAAAGG + Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
965939139 3:174155731-174155753 AAGAAATATCGAAATGAGTAGGG + Intronic
966128791 3:176611014-176611036 AAGACCTAACAGAATCAGCAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966543748 3:181120635-181120657 AAGAAAGAAAAGAGAGAGGAAGG - Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966793587 3:183694504-183694526 AAAAAAAAAAAAAATGAGGATGG - Intergenic
967329329 3:188275025-188275047 AAGAAATAACAGTTGGAGAAGGG - Intronic
967338068 3:188366498-188366520 AAGAAATGACGCATTGAGGAAGG - Intronic
967553744 3:190830994-190831016 GAGAAAGAACGGAAAGAGGAAGG + Intergenic
967644924 3:191911315-191911337 AAAAAAAAAAAGAAAGAGGAAGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968212053 3:196856957-196856979 AGGAAAGAAAAGAAAGAGGAAGG + Intergenic
968842580 4:3018579-3018601 AAGAAATTAAAGAAGGAGGCTGG + Intronic
968914499 4:3491426-3491448 AAGAAAGAAATGAATGAGCAGGG - Intronic
969156232 4:5212584-5212606 ATGAAATCACAGGATGTGGAGGG - Intronic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
970105164 4:12574438-12574460 AAGGAAGAAGAGAGTGAGGAGGG + Intergenic
970331544 4:14990867-14990889 GAGAAATCAGAGAATGAGGATGG + Intergenic
970792084 4:19869487-19869509 AAGTAATAACAAATTCAGGAAGG - Intergenic
970793154 4:19882950-19882972 AAGATTTAACAAAATGAGGCTGG + Intergenic
970960451 4:21865326-21865348 AAGAAATAAGTGGGTGAGGAAGG + Intronic
971033813 4:22670375-22670397 AAGAAATGAAAGGAGGAGGAAGG - Intergenic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
971216117 4:24663681-24663703 AAGAAATAAGGGAGGGAGGAGGG - Intergenic
971353433 4:25872872-25872894 GAGACACAACAGAATGAGCACGG - Intronic
971394402 4:26215022-26215044 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
971448778 4:26780139-26780161 AGGAAAGAACAGAAAGAGAAGGG + Intergenic
971467744 4:26982585-26982607 AAGACATAACACAATGAGCCTGG - Intronic
971545555 4:27880851-27880873 AAAAAAAAAAAGAATGTGGAGGG - Intergenic
971749915 4:30633620-30633642 AAGTAATTAATGAATGAGGATGG - Intergenic
971831242 4:31698631-31698653 AAGAAGTATCAGAATTATGAAGG - Intergenic
971881776 4:32383990-32384012 AAGAAACAGCAGAATGTGTAGGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972651336 4:41020504-41020526 AAGTACTTACAGAATCAGGAAGG + Intronic
972784833 4:42316735-42316757 AAGTACTTACAGAATCAGGAAGG + Intergenic
972998577 4:44915892-44915914 AAGAAACAACAGAAGGGTGATGG - Intergenic
973019699 4:45187473-45187495 AAAAAATAGCTGAGTGAGGAAGG + Intergenic
973881445 4:55275357-55275379 AAAAAAGAAGAGAAAGAGGAGGG + Intergenic
974246371 4:59324645-59324667 AAGAAAAAACATATTGAAGAGGG - Intergenic
974406435 4:61476910-61476932 AAGAAATAAAATAGGGAGGAGGG - Intronic
975023082 4:69514927-69514949 AAGACATTACATAATGGGGAAGG + Intronic
975275559 4:72495665-72495687 AAAAAATAACTGAAAGAGGTAGG - Intronic
975293150 4:72700864-72700886 ATGAAATAACAGAGAGTGGATGG - Intergenic
975436249 4:74355521-74355543 AAAAAATAACAGAATTAGGCGGG - Intergenic
975640672 4:76496759-76496781 AAGAATTGACTGAATGAGGAAGG - Intronic
977442260 4:97083116-97083138 AAGAAATAACCAAATTAGAAAGG - Intergenic
977773482 4:100888803-100888825 TAGAAATAACTGAATAAGGATGG - Intergenic
977879404 4:102187003-102187025 AAGAAAAAAAAGAAAGGGGACGG + Intergenic
977987604 4:103402429-103402451 AGGAAATAACTAAATCAGGATGG - Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978202679 4:106041246-106041268 AATTAATAACAGAATAAGAATGG + Intergenic
978324774 4:107540070-107540092 AAAAAATAAAAGAATGGGGAAGG + Intergenic
978556847 4:109990226-109990248 GAGAAATATCAGGATGAGGAAGG + Intronic
978915231 4:114117928-114117950 AAGAAAAAACAGAATTAAGATGG - Intergenic
978942262 4:114450433-114450455 GAGAAATTACATAATGATGAAGG + Intergenic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979266444 4:118708712-118708734 AAGAAATAACCTAAGGATGATGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979954758 4:126939054-126939076 CCTAAATAACAGAATCAGGAAGG - Intergenic
980096563 4:128497337-128497359 AACAGCTCACAGAATGAGGAAGG + Intergenic
980135120 4:128851264-128851286 TAGAAGTAAGAGGATGAGGAGGG + Intronic
980249715 4:130299330-130299352 AAGAAATAAAAGTAACAGGATGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980710341 4:136557996-136558018 AAGAAAAAACATTGTGAGGAAGG + Intergenic
980743811 4:136989231-136989253 AAGCAATAACTGAATGTGTAGGG - Intergenic
980909081 4:138977724-138977746 AATAAATGACAAACTGAGGAGGG - Intergenic
980925805 4:139136202-139136224 AAGAAATAAGACATTGACGATGG + Intronic
981006948 4:139884952-139884974 GAGAAACAACAGGATTAGGACGG + Intronic
981111476 4:140939439-140939461 AGGAAAGAAGAGAAAGAGGAAGG + Intronic
981169936 4:141610461-141610483 AAGAAATAATTGAATGCTGAAGG + Intergenic
981599956 4:146476150-146476172 AAGAAATCTATGAATGAGGAAGG + Intronic
981629558 4:146803204-146803226 AAAAAAAAACAGCATGAGAATGG + Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982348734 4:154391257-154391279 ACGAAATCAGAGAATGAAGACGG - Exonic
982410573 4:155071881-155071903 AAGAAAGTAGAGAAAGAGGAAGG + Intergenic
982486687 4:155974949-155974971 AATAAATAACAGTTGGAGGATGG + Intergenic
982649763 4:158073143-158073165 AAGAAAAGAAAGAAAGAGGAGGG + Intergenic
982765148 4:159337956-159337978 AAGAAACAGCAAAATGAGGCTGG + Intronic
982877523 4:160666541-160666563 AAGTACTTACAGAATCAGGAAGG + Intergenic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
983283178 4:165706893-165706915 AAGAAATTAGAGATTGAGGCTGG + Intergenic
983310272 4:166051330-166051352 AAGAAAGGAAAGAAAGAGGAAGG - Intronic
983340817 4:166458542-166458564 AAAAAATAGAAAAATGAGGACGG - Intergenic
983464856 4:168074490-168074512 TGGAAATAAAAGAATGAGAAAGG + Intergenic
983834450 4:172371060-172371082 AAGTACTTACAGAATCAGGAAGG - Intronic
983967503 4:173830935-173830957 AAGACAGAACAGAATAAGGAAGG + Intergenic
984094027 4:175411846-175411868 AAAAAAAAACAATATGAGGAGGG - Intergenic
984552011 4:181171671-181171693 AAGAAATAAAAGAAAGAAGAGGG - Intergenic
984568960 4:181366713-181366735 GATAAAAAACAGAGTGAGGAAGG - Intergenic
985237685 4:187894096-187894118 AAGAAAAAAAAGAAAAAGGATGG + Intergenic
985363633 4:189202677-189202699 AAGAAAGAAAAGAGAGAGGAAGG + Intergenic
986118309 5:4803041-4803063 AAGAGAGAAAAGAAAGAGGAAGG + Intergenic
986594482 5:9406909-9406931 AAGAGATTCTAGAATGAGGAAGG + Intronic
986931764 5:12833955-12833977 AAGAAATAACACAAGAGGGATGG + Intergenic
986958482 5:13185567-13185589 AAAAAATAAGAGAATTTGGATGG + Intergenic
987065123 5:14282150-14282172 AAGAAATACCAGAAGAAGAAAGG - Intronic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987437929 5:17920442-17920464 AAGATACAAAAGAATGTGGAAGG - Intergenic
987546843 5:19321593-19321615 AAAAAAAAAAAGAATCAGGAGGG - Intergenic
987678169 5:21103023-21103045 TAGAACTAACAGGCTGAGGAAGG + Intergenic
987705387 5:21457440-21457462 AAAAAAAAAAAAAATGAGGAAGG + Intergenic
987946504 5:24616125-24616147 AAAAAAAAAAAGAAAGAGGAAGG + Intronic
988131286 5:27109636-27109658 GAGAAATGACTGAATGAAGAAGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988329537 5:29817564-29817586 AATACATAAATGAATGAGGATGG - Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989026382 5:37073130-37073152 AACAAATGAGAGAATGATGAAGG + Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989781419 5:45269597-45269619 TCTAAATACCAGAATGAGGAGGG + Intronic
989964132 5:50449288-50449310 AAGTACTTACAGAATCAGGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990206642 5:53436759-53436781 AAGAAACTAGAGCATGAGGAAGG - Intergenic
990419392 5:55616641-55616663 AAGTACTTACAGAATCAGGAAGG + Intergenic
990960773 5:61391447-61391469 AAGAAATGTCAGGATGAGGATGG - Intronic
991072569 5:62500656-62500678 AAAAAATCAAAGAATTAGGAAGG - Intronic
991092919 5:62710144-62710166 AAGAAAGAAAAGAAAGAGGGAGG - Intergenic
991768288 5:70014031-70014053 ACAAAATAACAGCATGAGGAAGG - Intergenic
991847526 5:70889113-70889135 ACAAAATAACAGCATGAGGAAGG - Intergenic
992288523 5:75261058-75261080 AAGAAAAAAAAGAATGTTGAAGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992543524 5:77786995-77787017 TAGAAAGCACAGAATAAGGAAGG - Intronic
992807115 5:80348164-80348186 AAAAAAAAACGGAATTAGGAGGG + Intergenic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
992863077 5:80931731-80931753 GACAAATAAAAGAATGAGGGTGG + Intergenic
992870040 5:80996581-80996603 AAAAAAAAAAAGAAAGAGGAGGG - Intronic
992975494 5:82114272-82114294 AAGAAAGAACAGAATGTGGGAGG - Intronic
993234317 5:85283604-85283626 AAGTAATAATAGAATGGAGATGG - Intergenic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993824692 5:92668467-92668489 AAGAAATAAAAGAATGATTGTGG - Intergenic
993866378 5:93201399-93201421 AAAAAATAACAAAATCTGGAAGG + Intergenic
993981080 5:94544416-94544438 CAAAAATAACAGAATGAAGTAGG - Intronic
994067392 5:95558544-95558566 AAGAAATAAAAGAATTACAAGGG + Intronic
994447207 5:99891818-99891840 AGGAAATAACAGAATGCAGGAGG + Intergenic
994695103 5:103064089-103064111 TGGAAATGACAGAATGAGGAAGG - Intergenic
994756943 5:103805459-103805481 AAAGAATAAAAGAAGGAGGAAGG - Intergenic
995076863 5:107995196-107995218 AAGAAATAGCAGAATGGTGTAGG - Intronic
995085943 5:108109234-108109256 AGAAAATAGCAGAAGGAGGAAGG + Intronic
995283812 5:110364325-110364347 GAGAGATAACACACTGAGGATGG - Intronic
995369199 5:111399785-111399807 AAGAAAGAACATACCGAGGAAGG - Intronic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
996100344 5:119438872-119438894 AAGTACTTACAGAATCAGGAAGG + Intergenic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996531049 5:124527386-124527408 AAGAATTTTGAGAATGAGGAAGG + Intergenic
996626798 5:125579873-125579895 AATAAATAACAGAGCCAGGATGG - Intergenic
996809172 5:127494983-127495005 AAGAAAGAAGAGAAAGAGGAAGG + Intergenic
997050045 5:130369460-130369482 AACAAATAATATGATGAGGATGG + Intergenic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
997960260 5:138315746-138315768 AGTAAATAAAAGAATGAGGCTGG + Intronic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998027989 5:138837390-138837412 AAGAAACAACTAAATGAGTATGG - Intronic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998292972 5:140934532-140934554 AAGAAATGATAGAATTAGAACGG - Intronic
998515700 5:142751939-142751961 AATAAATAAATGAATGAGTATGG + Intergenic
998533925 5:142911404-142911426 AGGAAATAAAATAAGGAGGAGGG - Intronic
998653010 5:144142373-144142395 AAGATATAAACAAATGAGGAAGG + Intergenic
998888083 5:146715764-146715786 AAGAAATAATAGAAGGTGGAGGG - Intronic
998915422 5:147006279-147006301 AAGTACTTACAGAATCAGGAAGG + Intronic
999265737 5:150265643-150265665 AAGAAATAACTGAATGAAGCTGG + Intronic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000000220 5:157131314-157131336 AAAAACTAAAAGAATTAGGATGG + Intronic
1000588725 5:163132089-163132111 AAAAAAAAAAAGAATGAGAAAGG - Intergenic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1000631801 5:163599079-163599101 AGGAAATAATAGAAGGAGAAGGG + Intergenic
1000728845 5:164805660-164805682 AACTAATAAATGAATGAGGATGG + Intergenic
1000997796 5:167976121-167976143 AGGAAAGAAGAGAAAGAGGAAGG - Intronic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001241407 5:170074254-170074276 AAGAAAAAACAGAATGAATTTGG - Intronic
1001360235 5:171076928-171076950 AACAAATAAATGAAGGAGGAAGG + Intronic
1001377115 5:171271055-171271077 AAGAAATAACATAAAAAGGAGGG - Intronic
1001691644 5:173637310-173637332 AAAAAGTAACAAAATGAGGCTGG + Intergenic
1001736934 5:174013239-174013261 AAGAAATGAAAGAAAGAGGATGG - Intergenic
1002507351 5:179688950-179688972 AAAAAACAACAGAAAGAGGCCGG + Intronic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1002659043 5:180777860-180777882 AAAAAATTACATAATGGGGATGG - Intergenic
1002680688 5:180960692-180960714 AAGCAATAAGAGAATAAGAAAGG - Intergenic
1002829117 6:802755-802777 AAAAAAAAACAGTACGAGGACGG + Intergenic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003610190 6:7606533-7606555 AAAGAATAAGAGAAAGAGGAAGG - Intronic
1003714318 6:8629597-8629619 AAGAGCTAAGAGAATGATGATGG + Intergenic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004357463 6:14942496-14942518 AGAAAATAGCAGAAGGAGGAAGG + Intergenic
1004702603 6:18093117-18093139 AAAAAAAAAAAGAATTAGGAGGG - Intergenic
1004849289 6:19680485-19680507 AAGAAATAACAGAAGAATGCGGG + Intergenic
1004879945 6:19997336-19997358 AAGAAAGAAAAGAATAAGCAGGG + Intergenic
1004898806 6:20175165-20175187 TAAAAATAATATAATGAGGAAGG + Intronic
1005344897 6:24879602-24879624 AAGAAATAAAAGGAGGAGGTTGG + Intronic
1005427994 6:25723951-25723973 CAGAAATGACAGAATAAGGAAGG + Intergenic
1005442846 6:25889788-25889810 ATGAAACAAAAAAATGAGGAGGG + Intergenic
1005458823 6:26047995-26048017 AAGAAATACCAGAAGGAGAAAGG + Intergenic
1005478301 6:26230923-26230945 AAGGAATAAGAGAATTAGGTGGG - Intergenic
1005525249 6:26641276-26641298 GAGAAAGAACTGAATGAGGTGGG + Intronic
1006044216 6:31280710-31280732 AAGAAATGGCAGGATGAGGATGG + Intronic
1006085294 6:31590830-31590852 AAGAAAAAAGAAAAAGAGGAAGG - Intronic
1006202012 6:32302066-32302088 AATATATAAAAGAATGAGCATGG - Intronic
1006222072 6:32499636-32499658 AAGTACTTACAGAATCAGGAAGG + Intergenic
1006393162 6:33770781-33770803 AAGAAAGAACAGGGTGAGGTTGG - Intergenic
1006520170 6:34566787-34566809 AACAAACAAACGAATGAGGATGG + Intergenic
1007115010 6:39337143-39337165 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008253850 6:49274146-49274168 AAGAAATAACAGAATCACAAAGG + Intergenic
1008303687 6:49874107-49874129 AAAAAATAAACAAATGAGGAGGG + Intronic
1008683936 6:53903520-53903542 AAAAAATGACAAAATGAAGATGG - Intronic
1008803065 6:55393632-55393654 AGGAAGTAAGAGAAAGAGGAAGG + Intronic
1008993002 6:57625648-57625670 AATAAAAAAGAGAATGATGAAGG + Intronic
1009022915 6:57963467-57963489 AAAAAAAAAAAAAATGAGGAAGG - Intergenic
1009023579 6:57971129-57971151 AAAAAAGAAAAGAATGGGGATGG + Intergenic
1009181616 6:60524753-60524775 AATAAAAAAGAGAATGATGAAGG + Intergenic
1009417905 6:63436145-63436167 AGGAAAAAAGAGAATGAAGATGG - Intergenic
1009502154 6:64427800-64427822 AAGAAGTAACACAATGAAGTAGG + Intronic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1010041781 6:71393166-71393188 AGGAAATAACAGTCTCAGGAAGG - Intergenic
1010067746 6:71705055-71705077 AAAAAATAAAAGGATTAGGAAGG + Intergenic
1010075304 6:71790847-71790869 AAGTACTTACAGAATCAGGAAGG + Intergenic
1010484906 6:76398946-76398968 AATAAATAATAAAATGTGGAAGG - Intergenic
1010749026 6:79597335-79597357 AAAAAAGAAAAGAAAGAGGAAGG + Intergenic
1011449995 6:87482482-87482504 AAGTACTTACAGAATCAGGAAGG - Intronic
1011523418 6:88236587-88236609 AAGACATAACAGCAGGAAGAGGG + Intergenic
1011940243 6:92833992-92834014 CATAAATAACTGAATGAAGAAGG + Intergenic
1012144523 6:95665114-95665136 AAGAAAAGAGGGAATGAGGAAGG - Intergenic
1012319285 6:97822942-97822964 AAGAAAGAAAAGAAGGAGAAAGG + Intergenic
1012441059 6:99262776-99262798 AAGTACTTACAGAATCAGGAAGG - Intergenic
1012712859 6:102630260-102630282 GAGAAAGAATAGAAAGAGGAGGG + Intergenic
1013210607 6:107983518-107983540 AAAAAAAAACAGAATCAGGCTGG + Intergenic
1013297426 6:108770446-108770468 AGGAAATACCAGAATGAACAAGG - Intergenic
1013654095 6:112227363-112227385 AAGAAATAACATAGTCAGGCGGG - Intronic
1013880009 6:114886222-114886244 AAGAAATATTAGAAAGAGAAAGG - Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014940262 6:127429834-127429856 AAACAATAACAGAAGGAGGCTGG + Intergenic
1014957189 6:127635489-127635511 AAGAAATGAAAGAATAAGAATGG - Intergenic
1015124624 6:129739634-129739656 AAGAAAATACTGAATGAGAATGG - Intergenic
1015285500 6:131482152-131482174 AAGAAAGAAAAGAAAGAAGAAGG - Intergenic
1015380971 6:132568604-132568626 AATGAATATCAGAATGATGAAGG + Intergenic
1016630493 6:146224245-146224267 ATGAAATACCAGAGTGAGGTGGG + Intronic
1016784622 6:147996607-147996629 AAGAAAGAAAAGAATTAGAAGGG - Intergenic
1016816412 6:148307012-148307034 AAGAAAGAAAAGAAAGAGAAAGG - Intronic
1017018610 6:150121675-150121697 TAAAAATAACAGAAAGAGGCTGG - Intergenic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017095571 6:150801734-150801756 AAGAAATAAGAATTTGAGGACGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017974662 6:159346470-159346492 AAGAAATTAAAGAAAAAGGATGG + Intergenic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018352758 6:162978339-162978361 AAGAAAAAACACAATGTGTAGGG + Intronic
1018613978 6:165668734-165668756 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1018723865 6:166595771-166595793 AAGATATAAAAGAATAAGGATGG + Intronic
1019392982 7:799984-800006 AAAAAAAAACAGAAAAAGGAAGG + Intergenic
1019772270 7:2891175-2891197 AAGAAAAAAAAAAAAGAGGAGGG - Intergenic
1019772949 7:2895124-2895146 AAAAAAAAAAAGAATGAGAAGGG - Intergenic
1019963261 7:4478905-4478927 AATAAATAAAAGAATGAGCCTGG + Intergenic
1020155027 7:5716035-5716057 AATAAATAAAAGAATGGGGCTGG - Intronic
1020179880 7:5913936-5913958 AAGAAATGCCAGAATGAGCAGGG - Intronic
1020303055 7:6810948-6810970 AAGAAATGCCAGAATGAGCAGGG + Intronic
1020477304 7:8612152-8612174 GAGAAATGACAGAAAGAGAAAGG - Intronic
1020496322 7:8857726-8857748 AACAAACAACATAGTGAGGAAGG - Intergenic
1020530717 7:9330808-9330830 AAGAAAAAAGAAAAAGAGGAAGG - Intergenic
1020587561 7:10088191-10088213 AGGAAATCACAGAAGCAGGAAGG + Intergenic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021449320 7:20768059-20768081 AAGAAATAACACAAGAAGGCCGG + Intronic
1021584435 7:22193021-22193043 AAGAAATACAAGGAGGAGGAGGG - Intronic
1021629170 7:22626925-22626947 AAGATATGACAAAATAAGGAGGG - Intronic
1021788725 7:24178598-24178620 AAGAAATAAAGGAATGGGGAAGG + Intergenic
1022018926 7:26379500-26379522 AAGAAAAATAAGAATGAAGAGGG - Intergenic
1022070420 7:26908458-26908480 AAGAAAGAAAAGAAAGGGGAGGG + Intronic
1022076785 7:26979153-26979175 AAGAAATAACAAAAGCAGGCTGG - Intronic
1022357013 7:29625663-29625685 AAGAAAGAAGAGAGAGAGGAAGG + Intergenic
1022439721 7:30423778-30423800 AAGAAAGAAGGGAATGAGCATGG - Intergenic
1023077735 7:36500469-36500491 AAGTACTTACAGAATCAGGAAGG - Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023436484 7:40145745-40145767 AAGTACTTACAGAATCAGGAAGG - Intronic
1023798955 7:43816388-43816410 AAGTACTTACAGAATCAGGAAGG + Intergenic
1023944635 7:44793955-44793977 AAGAAGTAAATGAATGAGGCCGG - Intergenic
1024496199 7:50049010-50049032 AAGAAATAAAAGAATTACAAAGG + Intronic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1024769558 7:52704018-52704040 AGGAAATTACAGACTGATGAAGG + Intergenic
1024878217 7:54052428-54052450 AAAAAATAATAGAATGAATAAGG - Intergenic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026483229 7:70796635-70796657 AAAAAATAAAAGAATGAGCCAGG - Intergenic
1026517630 7:71086639-71086661 AAGAAAAAAAAGAAAGAGAAGGG + Intergenic
1026585243 7:71650723-71650745 AAGAAATGACAGTAGAAGGATGG + Intronic
1026607373 7:71827472-71827494 AAGAAACAAAAGAGTGAGGACGG + Intronic
1026617343 7:71917228-71917250 CAGAAACAACAGGATGAGGCAGG + Intronic
1026733161 7:72928952-72928974 AAGAAAGACTAGAATGAGGCAGG + Intronic
1027110869 7:75438637-75438659 AAGAAAGACTAGAATGAGGCAGG - Intronic
1027210525 7:76143272-76143294 AAAGAATAACTGAATGAGTAAGG + Intergenic
1027297300 7:76790522-76790544 CCCAAATTACAGAATGAGGAGGG + Intergenic
1027298172 7:76800010-76800032 AAGAAATACATGTATGAGGAGGG + Intergenic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1027441078 7:78219760-78219782 AAGGAATGACAGAATGTGAAAGG - Intronic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1027799190 7:82731112-82731134 AATAAATAAAAGAATGTTGAAGG + Intergenic
1027828965 7:83153818-83153840 AAGAAATAAAACAGTGAAGATGG - Intronic
1028251141 7:88541286-88541308 AAGAGATAAGAAAATGAGCAAGG - Intergenic
1028433828 7:90778688-90778710 AATAAAGAAGAGAAGGAGGAAGG - Intronic
1028686720 7:93598080-93598102 AAGAAATAACAGATTGTGGAAGG - Intronic
1029249364 7:99225057-99225079 AAGAAAGGAAAGAAAGAGGAAGG - Intergenic
1029748748 7:102531223-102531245 AAGAAAGAAAGGAAAGAGGAAGG - Intergenic
1029766695 7:102630307-102630329 AAGAAAGAAAGGAAAGAGGAAGG - Intronic
1029809439 7:103033208-103033230 AAGAAAGACAAGAATGGGGATGG + Intronic
1030063385 7:105640683-105640705 AAAAAATAACAAAATCAGGCAGG - Intronic
1030266932 7:107630614-107630636 AAGAGATAGGAGACTGAGGAAGG + Intergenic
1030272625 7:107686389-107686411 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1030324191 7:108202795-108202817 AAGAACTAAGAGAATGAGAATGG - Intronic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1030486390 7:110174097-110174119 AAGAAATAACAAAGAGAGAAAGG - Intergenic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1031018963 7:116605998-116606020 AAGAAAGGAGAGAAAGAGGAAGG + Intergenic
1031123814 7:117750439-117750461 AATAAATAACTGAATTAGGTAGG + Intronic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031716361 7:125113773-125113795 AAGAAAGAACAGAATAAAGAGGG + Intergenic
1031888104 7:127261808-127261830 AAGAAATCAAATAAGGAGGAAGG + Intergenic
1031961557 7:127994692-127994714 AAGAAAAAACAGAGTTAGCATGG - Intronic
1032798962 7:135302872-135302894 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
1032843353 7:135732132-135732154 AAGAAAGAACAGACTGTGAAGGG + Intronic
1033321094 7:140340282-140340304 AAAAAAAAAAAGAATGAGGTTGG - Intronic
1033449073 7:141447021-141447043 AACAAATAAATGAATGAGTACGG - Intronic
1033548730 7:142425977-142425999 AAAAAAAAACAAAATGATGATGG - Intergenic
1034069006 7:148164580-148164602 AAGAAAGCACAGAGTTAGGATGG - Intronic
1034579414 7:152029611-152029633 AAGTACTTACAGAATCAGGAAGG - Intronic
1034793986 7:153995598-153995620 AAAAAAAAAAAGAATGAAGAAGG + Intronic
1035067116 7:156114334-156114356 AAGAAAGAATAGAAGGAAGAAGG + Intergenic
1035789849 8:2294816-2294838 AAGAAATATCAAAATTAGGCTGG - Intergenic
1035802956 8:2426889-2426911 AAGAAATATCAAAATTAGGCTGG + Intergenic
1035948576 8:3993242-3993264 AAATAATAACAACATGAGGAGGG + Intronic
1036483485 8:9158834-9158856 AAGAATTAACAGAAAGAAAATGG - Intronic
1036598285 8:10234537-10234559 AAGAAATTAAAGGAAGAGGATGG + Intronic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1037209836 8:16373362-16373384 GAGAAAGAAAAGAAGGAGGATGG - Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1037914580 8:22765097-22765119 AAGAAATAAAGGAAGGAAGAAGG - Intronic
1038179837 8:25215630-25215652 TAGAAATAACACAATGACCAAGG - Intronic
1038349228 8:26761330-26761352 CAGAAATGAGAGAGTGAGGAGGG + Intronic
1038395037 8:27240336-27240358 AAAAAATCAAAGAATGTGGAAGG - Intronic
1038473639 8:27846012-27846034 GATAAATAAGAGAATGAGGGAGG - Intergenic
1039182081 8:34878188-34878210 AAGAAAGAAAAGAAAAAGGAGGG + Intergenic
1039239213 8:35536690-35536712 AAGAAATAACATAAAAAGCAAGG + Intronic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039335759 8:36587430-36587452 AGGAAATGAAAGAATGAGTAGGG + Intergenic
1040066178 8:43145875-43145897 ACTTAATAACACAATGAGGAAGG - Intronic
1040279486 8:46031671-46031693 TAGAAATAACCGAATGAGTGTGG - Intergenic
1040592718 8:48809392-48809414 AACAAACAACAGAATGATAATGG + Intergenic
1040667416 8:49651120-49651142 AAGTACTTACAGAATCAGGAAGG - Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041396794 8:57399884-57399906 AAGAAAGAAAAGAAAGAGAAAGG - Intergenic
1041556763 8:59165846-59165868 AATAAATAAGAGTAAGAGGATGG + Intergenic
1041573492 8:59365853-59365875 AAAAAATTACAAAATGAGAAGGG - Intergenic
1041871052 8:62634752-62634774 AACAAAGAAGAGAAAGAGGAGGG + Intronic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042118864 8:65462041-65462063 AAAAAAAAAAAGAATAAGGAAGG + Intergenic
1042154715 8:65831660-65831682 AAAAAATCACAGAATCACGAAGG + Intronic
1042491910 8:69409354-69409376 AAGAACTAGCAGAAAGAGAAGGG + Intergenic
1042495311 8:69449084-69449106 ATAAAATATCAGAATGAGAATGG + Intergenic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042767337 8:72338042-72338064 AAGACGTAACAGAATCAGGAAGG - Intergenic
1042972219 8:74422146-74422168 AAGAAAGAAGAAAATGAAGAAGG - Intronic
1043008111 8:74845905-74845927 AAAAAATAAGAGAAGGAAGAAGG - Intronic
1043027675 8:75091315-75091337 AATAAATTAAAGAATGAGAAAGG - Intergenic
1043369247 8:79571937-79571959 AAGAAATGGCTGGATGAGGACGG - Intergenic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043613336 8:82092932-82092954 AAGTACTTACAGAATCAGGAAGG - Intergenic
1043659390 8:82717137-82717159 AAGAAAGAAAAGAAATAGGAAGG + Intergenic
1043879759 8:85529120-85529142 AATAAATAAATGAATGAGGCTGG + Intergenic
1043990453 8:86746585-86746607 AATAAATAACAGGAAGAAGATGG + Intergenic
1044376026 8:91472051-91472073 AAGGAATAAAAGATTGATGAAGG + Intergenic
1044456189 8:92395027-92395049 AAGTACTTACAGAATCAGGAAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044868831 8:96598640-96598662 AAAAAATAAGAGAATGAGCATGG + Intronic
1044895063 8:96882748-96882770 AAAAAATAAAAGAATGAGTCAGG - Intronic
1045155774 8:99468932-99468954 AAGAAAAGAAAGGATGAGGATGG - Intronic
1045200763 8:99978479-99978501 AAGAAAGAAAAGAGGGAGGAGGG - Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045866734 8:106874904-106874926 AAGAAATCAGAGACTGAGGAAGG + Intergenic
1045958352 8:107936448-107936470 AAGAAAAAACAGAATAACAATGG - Intronic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046283556 8:112066287-112066309 AAGAAATAGCTGAAAGAGGCAGG - Intergenic
1046603160 8:116341094-116341116 AACAAATAACACAATCAGGGTGG + Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1047444746 8:124909439-124909461 AAGTACTTACAGAATCAGGAAGG + Intergenic
1049768574 8:144367882-144367904 AAGAAATATCAGATTGGGGCTGG - Intergenic
1049918615 9:342756-342778 AAGGAATAACAGGATGGGCATGG - Intronic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1050370309 9:4914621-4914643 AATAAATAAATGAATGAGAAGGG - Intergenic
1050548912 9:6732391-6732413 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1050593923 9:7187071-7187093 AAAAATTATCAGTATGAGGAGGG + Intergenic
1050714475 9:8506753-8506775 ATGAAATAACAGATTGTAGAAGG - Intronic
1050818118 9:9840791-9840813 AAAAAAAAACAGAAAGGGGAAGG + Intronic
1051147337 9:14041441-14041463 AAGAAATGGCAGGATGAGGATGG - Intergenic
1051381410 9:16462792-16462814 AACAAAGAACAGAAAGAGGGAGG - Intronic
1051524242 9:18024923-18024945 AAGAAATCAAAGAATGACAAAGG - Intergenic
1051950456 9:22624782-22624804 AAGAAAGAAGAGAATAGGGAGGG + Intergenic
1052055103 9:23896925-23896947 TAGAAATAAAACAAAGAGGAGGG + Intergenic
1052270465 9:26623059-26623081 AAGAAATAAATAAATGAAGAAGG + Intergenic
1052280411 9:26726681-26726703 AGTAAGTGACAGAATGAGGATGG + Intergenic
1052289982 9:26829450-26829472 AAGTACTTACAGAATCAGGAAGG + Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1053585878 9:39458182-39458204 AAATAATAACAGAATCAGGAGGG + Intergenic
1054580428 9:66907040-66907062 AAATAATAACAGAATCAGGAGGG - Intronic
1054913049 9:70471615-70471637 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055457959 9:76490674-76490696 AAGTACTTACAGAATCAGGAAGG - Intronic
1055867985 9:80839017-80839039 AAGAAATAACTGAAATATGAAGG + Intergenic
1056846564 9:90043012-90043034 AATAAATAACACGATGAAGAAGG + Intergenic
1057300424 9:93876239-93876261 CAAAAATAACATAAAGAGGAGGG + Intergenic
1057314741 9:93960983-93961005 AAAAAACAAAAGAAAGAGGAGGG - Intergenic
1058110066 9:101022930-101022952 AATGAATAAAAGAATGAGAATGG - Intergenic
1058397583 9:104572542-104572564 TGGAAATAACAGAAAGAAGAAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1058684538 9:107468634-107468656 AAGAGATAACAACATGAGCAAGG + Intergenic
1058999070 9:110329552-110329574 AAGACATAACAGAATGTGCGTGG + Intronic
1059028055 9:110658460-110658482 AAGACCTAAGAGAATGAGCAAGG + Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059097150 9:111430194-111430216 AATACATAACCGAATGAGCATGG - Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059282153 9:113144204-113144226 AAGAAAGAAAAAAATGGGGAGGG - Intergenic
1059633818 9:116153874-116153896 ATGAAATAAAACAAGGAGGAAGG + Exonic
1059770539 9:117419787-117419809 AAGAATTGACAGACGGAGGATGG - Intergenic
1059796685 9:117705097-117705119 AAAAAATAAGAGAATGAAAAAGG + Intronic
1060199160 9:121641818-121641840 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060442076 9:123650302-123650324 AAGAAATAATAAAATAATGAAGG + Intronic
1060493543 9:124101795-124101817 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1061362644 9:130153542-130153564 AAGAAAGAAAAGAATGAAAAAGG + Intergenic
1061613345 9:131763029-131763051 AAAAAATAAAATAATGATGATGG + Intergenic
1185797286 X:2977304-2977326 ACGAAAGAAAAGAAAGAGGAAGG - Intergenic
1185803614 X:3035807-3035829 AAGAAATAGCAGAATGGGGGCGG - Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1185957955 X:4513055-4513077 AAAAAATAACAGATTGGGCAGGG + Intergenic
1186097265 X:6115995-6116017 AATAAAGAACTGAATGAGGCTGG + Intronic
1186107103 X:6219421-6219443 AAGAAAGAAGAGAAAAAGGAAGG - Intronic
1186217156 X:7312457-7312479 AAGAACTTACTGAATGAGTAGGG + Intronic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1187670297 X:21659331-21659353 AAAAAATAACTTTATGAGGAAGG - Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1187969507 X:24645886-24645908 AAGAAATAACAGTTTTATGATGG + Intronic
1188458367 X:30393649-30393671 AGGGAATAACAGAGTGAGAAAGG + Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188780763 X:34281567-34281589 AAGAAATAAAACAAAGAGGCTGG + Intergenic
1189191310 X:39109626-39109648 CTGAAATAACAAAAAGAGGAGGG - Intergenic
1189230273 X:39446741-39446763 AGGAAATACTACAATGAGGAAGG - Intergenic
1189433298 X:40968706-40968728 AAAAAAAAAAAGAATGAAGAAGG - Intergenic
1189688026 X:43586278-43586300 ATGAAATGAGAGCATGAGGATGG - Intergenic
1189698230 X:43687980-43688002 AAGAAAGAACAGAATGTAGGCGG - Intronic
1189793144 X:44622546-44622568 AAAAAAAAAAAGCATGAGGAAGG + Intergenic
1189953275 X:46253794-46253816 TAGAAATAGCAGAGTAAGGATGG + Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1192035715 X:67560725-67560747 AAAAAACAAGAGAGTGAGGATGG - Intronic
1192121977 X:68464878-68464900 AAGAAATATGAGAGTGAGGAGGG + Intergenic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192482291 X:71496014-71496036 AAGTACTTACAGAATCAGGAAGG - Intronic
1193217085 X:78876015-78876037 ATGAATTGACAGAATGAGGTAGG + Intergenic
1193455013 X:81720911-81720933 AAGAAACAAAAGTATAAGGAAGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194097494 X:89660518-89660540 TAGAAATAATACAATGAGGAGGG - Intergenic
1194327499 X:92538437-92538459 AAGAAAGAAAAGAATGAGAGAGG - Intronic
1194516081 X:94855484-94855506 AAAAAATTACAGAATATGGATGG + Intergenic
1195433250 X:104812966-104812988 AAGAATTAGCAAAATGAGCAAGG + Intronic
1195947181 X:110227645-110227667 ATGAAAGAACAGAATGGGGGTGG + Intronic
1196106192 X:111898521-111898543 AAGAAATAATGGAAGGAGGGAGG - Intronic
1196126901 X:112110679-112110701 AAGTACTTACAGAATCAGGAAGG - Intergenic
1196643113 X:118086542-118086564 GAGAAATAAAAGAATAAGGTAGG + Intronic
1196724247 X:118881748-118881770 AAGAAATAACACAATGATATAGG - Intergenic
1196874615 X:120146418-120146440 AAGAAATTAAAGAATGTGTAAGG + Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197667100 X:129235957-129235979 AAGAAATAATGTAATGATGATGG - Intergenic
1197678958 X:129361952-129361974 CAAACATAACAGAATGCGGAAGG + Intergenic
1197869612 X:131052553-131052575 AAGAAATTAAAGTTTGAGGAAGG - Intergenic
1198159036 X:133988774-133988796 AAGATATAACAAAATGTGTAGGG + Intergenic
1198239551 X:134770076-134770098 AAGAAATAACTGAAATATGATGG - Intronic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198742328 X:139854195-139854217 AAGTACTTACAGAATCAGGAAGG + Intronic
1198848344 X:140937857-140937879 GTGACATAACAGAATGAGCATGG - Intergenic
1199058210 X:143322705-143322727 AAGATATGACACTATGAGGAAGG + Intergenic
1199112196 X:143948074-143948096 AAGACATAAAAGAAAGAGCATGG - Intergenic
1199330905 X:146557735-146557757 AGGAAATAAGAAAATGAAGAAGG - Intergenic
1199557234 X:149122681-149122703 AGGAAATGGCAGAATGATGATGG - Intergenic
1199895652 X:152125154-152125176 AAGAATGAACATAATGAGAATGG + Intergenic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1200450514 Y:3321892-3321914 TAGAAATAATACAATGAGGAGGG - Intergenic
1200837976 Y:7751564-7751586 AACAAAAAACAGGATGAGGGAGG + Intergenic
1201016505 Y:9608226-9608248 AAGAATTAAAAGAGTGAAGATGG + Intergenic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic
1201271739 Y:12262394-12262416 AAGTACTTACAGAATCAGGAAGG - Intergenic
1201568175 Y:15387807-15387829 AAGTACTTACAGAATCAGGACGG - Intergenic
1201741195 Y:17325976-17325998 AAGAAAGAAAAGAATAAAGAAGG + Intergenic
1201791458 Y:17845688-17845710 AAGAAATAAAAGAATTGGCATGG - Intergenic
1201810096 Y:18060301-18060323 AAGAAATAAAAGAATTGGCATGG + Intergenic
1202089673 Y:21176709-21176731 AAGTACTTACAGAATCAGGAAGG - Intergenic
1202353070 Y:24015338-24015360 AAGAAATAAAAGAATTGGCATGG - Intergenic
1202517709 Y:25654777-25654799 AAGAAATAAAAGAATTGGCATGG + Intergenic