ID: 1127809106

View in Genome Browser
Species Human (GRCh38)
Location 15:62548046-62548068
Sequence CCACAAGCATAGTCTCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127809106_1127809110 3 Left 1127809106 15:62548046-62548068 CCAGCCCGAGACTATGCTTGTGG 0: 1
1: 0
2: 1
3: 7
4: 59
Right 1127809110 15:62548072-62548094 GATACTTAAAAGTATAAAATAGG 0: 1
1: 0
2: 3
3: 66
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127809106 Original CRISPR CCACAAGCATAGTCTCGGGC TGG (reversed) Intronic
904770526 1:32878679-32878701 CCCCATGCATAGTCTCAGGGAGG + Intergenic
904824320 1:33264754-33264776 CCAGATGCATGGTCTTGGGCAGG + Intronic
922255250 1:223888088-223888110 CCAGATGCAGAGTCTCGGACGGG - Intergenic
922298003 1:224268953-224268975 TCAAAAGCTTAGTCTAGGGCCGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1069568597 10:69480234-69480256 TCAGAAGCACAGTCTCAGGCAGG + Intronic
1076600714 10:131655266-131655288 CCCCAGGCAAAGTCTCTGGCTGG + Intergenic
1077238962 11:1500726-1500748 CCACTACCATGGTCTCAGGCAGG + Intronic
1090400435 11:126445261-126445283 CCACAGGCATTGTCTGGGCCAGG - Intronic
1101842656 12:108339446-108339468 CCACAAGCCCAGTCCCCGGCTGG - Intergenic
1106876703 13:34082438-34082460 CCACAAGCTCAGTCTAGGACTGG - Intergenic
1111433653 13:88178425-88178447 CAACATGCATAGTTTCAGGCAGG - Intergenic
1115947162 14:38675205-38675227 TCACAAGCATTGTCTGAGGCAGG + Intergenic
1117247746 14:53902496-53902518 CCACATGCAAAGTCTTGGGCTGG + Intergenic
1121985402 14:98500681-98500703 CCACAAGCATGGTATATGGCTGG + Intergenic
1127809106 15:62548046-62548068 CCACAAGCATAGTCTCGGGCTGG - Intronic
1128231887 15:66040970-66040992 AAACAGGCATGGTCTCGGGCAGG - Intronic
1137361639 16:47821992-47822014 CCACCAGCCTAGTCTCCAGCGGG + Intergenic
1138555130 16:57766449-57766471 CCACGACCATAGCCTCGGGCTGG + Intronic
1140128522 16:72137559-72137581 CCACAAGCGTTGTCTCTGGCTGG - Intronic
1140213387 16:72988274-72988296 TCATAAGCACAGTCTAGGGCAGG + Intronic
1141071112 16:80955190-80955212 CCACAAGCATAGTCACCAGCAGG + Intergenic
1148125259 17:45233389-45233411 CCACAAGCACAGCCTTGTGCAGG - Intronic
1154993560 18:21618926-21618948 CCTCAAGAATAGTCTAGTGCGGG + Intronic
1158517030 18:58139201-58139223 CTGCATGCATAGTCTAGGGCTGG + Intronic
1162033919 19:7929189-7929211 CCACAGGGATGGACTCGGGCAGG + Intronic
1163503505 19:17689621-17689643 TCACAAGCATGGCCTTGGGCAGG + Intergenic
1164943286 19:32268441-32268463 CCACAAGCAGAGCCTGGGTCTGG - Intergenic
1167211438 19:48136329-48136351 CCACTAGCATAGACTGGGGAGGG + Intronic
929821811 2:45280372-45280394 CCACAATCAGAGTCTCAGGCTGG + Intergenic
934722782 2:96593247-96593269 CCACTAGAACAGTCTTGGGCTGG - Exonic
945314860 2:208360475-208360497 GCACAAGCACAGTCTCAGCCGGG - Intronic
945408154 2:209476166-209476188 CCACAATCATGGTCTCGAGAAGG - Intronic
1173871234 20:46343479-46343501 CCACCAGCAGAGGCTGGGGCAGG + Intergenic
1175966963 20:62664627-62664649 CCACAGGCATAGGCTCAGCCTGG + Intronic
1176017925 20:62946277-62946299 CGACAAGCATGGTCTAGGTCTGG + Exonic
1179035779 21:37757806-37757828 CCACACGCCTAGTCACTGGCTGG + Intronic
1182024670 22:27108813-27108835 CCACAAGCATAGTCTCCGCCAGG + Intergenic
950530771 3:13551177-13551199 CCTCAAGCATAGGCCCAGGCTGG + Intronic
968605113 4:1531784-1531806 CCCCAAGGATAGGCTCGGCCTGG + Intergenic
969129875 4:4983471-4983493 CCACAAGCCTATTCTCTGTCTGG - Intergenic
969717440 4:8874615-8874637 GCCCAAGAACAGTCTCGGGCAGG + Intergenic
981485450 4:145281316-145281338 GCCCAAGCATATTCTGGGGCAGG + Intergenic
986588545 5:9344923-9344945 GCACATGCATAGCCTTGGGCAGG - Intronic
987091037 5:14507876-14507898 CCACCAGGATATTCTCAGGCTGG - Exonic
987840461 5:23216993-23217015 CTACAAGCAAAGTCTCTGGCTGG + Intergenic
996033080 5:118728380-118728402 GCACGTGCATAGTCTCAGGCAGG - Intergenic
997449764 5:133972785-133972807 CCACAAGCTTGGTCTAGGACTGG - Exonic
1001078481 5:168648192-168648214 CCACAAGAAGAGCCTCAGGCAGG + Intergenic
1005903651 6:30241643-30241665 AAACAAGGATAGTCTCGGGCTGG - Intergenic
1006897807 6:37482008-37482030 CCCCAAGCACAGTCCCGTGCAGG - Intronic
1008817002 6:55580008-55580030 CATCAAGAATAGTCTCGTGCAGG + Intergenic
1016381767 6:143491331-143491353 CCACAAGCTTGGTCTAGGACTGG + Intergenic
1018647389 6:165961087-165961109 CCACAAGCCTGGCCTCGGACTGG - Intronic
1018894244 6:168002211-168002233 CTTCAGGCATAGCCTCGGGCAGG + Intronic
1026927850 7:74206375-74206397 CCAGGTGCATAGTCTGGGGCTGG + Intronic
1027363690 7:77434826-77434848 CCACAAGCATGGTTTCCAGCTGG - Intergenic
1040307080 8:46217651-46217673 CCCCCAGGATAGTCCCGGGCTGG - Intergenic
1044712314 8:95069941-95069963 CCAGATGCATAGGCTGGGGCTGG + Intronic
1049796106 8:144497939-144497961 TCACAAGCAGAGCCTAGGGCAGG - Intronic
1061312949 9:129775884-129775906 CACCAAGCATAGTGTCTGGCAGG - Intergenic
1189462494 X:41253677-41253699 CAACAAGCCTAGCCTCGCGCAGG - Intergenic
1190359076 X:49632514-49632536 CCACAAGCTTGGTCTAGGACTGG - Intergenic
1193391124 X:80930313-80930335 CCACAAGCTTGGTCTAGGACTGG + Intergenic
1194283548 X:91982666-91982688 CCACAAGCTTGGTCTAGGACTGG - Intronic
1196468219 X:115994017-115994039 CCATAAGCACAGTCTCCAGCAGG + Intergenic
1200601123 Y:5207229-5207251 CCACAAGCTTGGTCTAGGACTGG - Intronic
1200742129 Y:6864940-6864962 ACATAAGCACAGTCTAGGGCAGG - Intergenic