ID: 1127816009

View in Genome Browser
Species Human (GRCh38)
Location 15:62609397-62609419
Sequence TTCATTATAAAGGACATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127816009 Original CRISPR TTCATTATAAAGGACATGGC TGG (reversed) Intronic
901340467 1:8494285-8494307 TTTATTTTAAAGCACATGGAGGG - Intronic
901675649 1:10882180-10882202 TTCATGCTAAGGGACATGGAAGG - Intergenic
902834505 1:19037946-19037968 TTCATTATCAAGGTCATGCTTGG + Intergenic
903232929 1:21932920-21932942 TTCATTAGAAAAGAAAAGGCTGG + Intronic
904017775 1:27436147-27436169 TTTATGTTAAAGAACATGGCTGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
907715830 1:56925127-56925149 GTCTTAATAAAGGACATGGAGGG - Intergenic
907727715 1:57035391-57035413 TTCATTATATGGGACATGGTGGG - Intronic
907764173 1:57392174-57392196 TTCATCATATTGGCCATGGCTGG - Intronic
907950726 1:59180996-59181018 TTCCTTATAAAGGTCAAAGCTGG + Intergenic
908183478 1:61629059-61629081 TTTATTATAAAAGAGAGGGCTGG - Intergenic
908428447 1:64032044-64032066 TTCATTATACAAAATATGGCCGG + Intronic
908502289 1:64756042-64756064 TTCACTGTAAAGGACATTGATGG - Intronic
909925176 1:81430187-81430209 TACAATATAAAGCTCATGGCTGG - Intronic
911517843 1:98889793-98889815 TTCATTAGAAAGCCCATGCCTGG + Intergenic
911810812 1:102277364-102277386 TTCATTCTAAAATACATGCCTGG + Intergenic
912857850 1:113187534-113187556 TTCATTTTAAAGTAGATTGCAGG + Intergenic
915512402 1:156393275-156393297 TTCATAAAAGAGGACATGGCAGG - Intergenic
916153909 1:161825577-161825599 TTTATTATAAAGGATATGTGGGG + Intronic
917187171 1:172371581-172371603 TACATTTTATAGGACAGGGCAGG - Intronic
919158912 1:193803401-193803423 TGTATTATAGAGGACAAGGCAGG + Intergenic
920831451 1:209469397-209469419 GTCAGTTTAAAGGAAATGGCAGG + Intergenic
921826109 1:219673646-219673668 TTCATTATAAATTATGTGGCTGG - Intergenic
922539637 1:226408817-226408839 TTCATAATAAAGGAAATGCTAGG - Intergenic
923974551 1:239247160-239247182 TTCATTTTAAAGAAGAAGGCTGG - Intergenic
1062944562 10:1450671-1450693 TTTATTCTGAAGGTCATGGCAGG + Intronic
1063523373 10:6760932-6760954 TACAGGATAGAGGACATGGCTGG - Intergenic
1064647229 10:17472091-17472113 TTCATTAGAGAGGACAAAGCTGG - Intergenic
1064809066 10:19173918-19173940 CTCATCACAAGGGACATGGCTGG + Intronic
1066321128 10:34305148-34305170 GTCATTATAAAAGAAATGGAAGG + Intronic
1067201613 10:44177110-44177132 TTGCTTATAATGGACATGTCAGG + Intergenic
1067569256 10:47359750-47359772 TGGATTATAAAGGCCCTGGCAGG + Intergenic
1069156515 10:65036816-65036838 TTCTTTATAAAGCAAATGCCAGG - Intergenic
1070063195 10:73006318-73006340 TTCTTTAAAAAGGACTTGGGAGG + Intergenic
1071241431 10:83709618-83709640 TGCATTATAAGGAGCATGGCAGG + Intergenic
1073973001 10:109066041-109066063 TTCATGATAAATGACATGAGTGG - Intergenic
1074970071 10:118528780-118528802 TTCATTCTAAAGGCCAAGGGAGG + Intergenic
1075969714 10:126642234-126642256 TTCAATTTAAAAGACAAGGCTGG + Intronic
1077263227 11:1634443-1634465 TTAAATGTAAAGGAAATGGCTGG + Intergenic
1080090758 11:28345908-28345930 TTCATTATAAATGTCATTCCTGG - Intergenic
1081333932 11:41840346-41840368 TTCAATATAAAGCAAAAGGCAGG + Intergenic
1081721169 11:45289655-45289677 GGCATTCTAGAGGACATGGCTGG + Intergenic
1082649956 11:55777354-55777376 TTCATTATAAATGTCTTGGAGGG + Intergenic
1084551607 11:69846577-69846599 TGCATTTTAAAGGACAGGTCTGG + Intergenic
1085401985 11:76240960-76240982 TTCATTAGACTGGACATGCCTGG - Intergenic
1086933347 11:92717857-92717879 ATCATAATAAAGATCATGGCTGG - Intronic
1088402460 11:109436223-109436245 TTCATATTAAATCACATGGCAGG - Intergenic
1089551096 11:119278684-119278706 TTCATGATGAAGGAATTGGCTGG + Exonic
1090344047 11:126053141-126053163 TTCATCCAAAAGGAAATGGCAGG - Intronic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1092335962 12:7634012-7634034 GTCATTTTCAGGGACATGGCTGG + Intergenic
1094439015 12:30454420-30454442 TTCAGTATAAAGGTTTTGGCTGG + Intergenic
1096064446 12:48728410-48728432 TTCACTAAAAAGGGGATGGCCGG + Intergenic
1097674451 12:62583646-62583668 TTCAGTATAAAAGACATTGGAGG + Intronic
1097746477 12:63309493-63309515 TTAATTAGAAAGGACATTGTTGG - Intergenic
1099233960 12:80060015-80060037 TGCATTATAAATGCCAAGGCAGG - Intergenic
1099661288 12:85566837-85566859 ATCATAATAAATGTCATGGCAGG - Intergenic
1100140089 12:91607497-91607519 CTCATTATCTAGGACATGGTAGG + Intergenic
1100208520 12:92377104-92377126 TTCATTATTAATGAAAAGGCAGG - Intergenic
1106666532 13:31857086-31857108 ATCATAGTAATGGACATGGCTGG - Intergenic
1106906642 13:34416260-34416282 TTCATTATAGCAAACATGGCAGG + Intergenic
1109328009 13:60893310-60893332 TTTATTATACTGGACATTGCTGG - Intergenic
1110997403 13:82129785-82129807 TTCATTATATAGCACATAGCAGG - Intergenic
1113594258 13:111520247-111520269 TTCATTAGAAAGGTCAATGCTGG - Intergenic
1115394566 14:32893589-32893611 TTTATTTTAAAGATCATGGCTGG + Intergenic
1117393150 14:55281894-55281916 ATCTTTAGAAAGGACATAGCTGG + Intronic
1117617448 14:57548159-57548181 TTGCTTATAAAGGCAATGGCAGG + Intergenic
1120008197 14:79383891-79383913 TACATTATAAAGGAAAGGGAGGG - Intronic
1120802335 14:88704619-88704641 ATGATTATAAAGGACATTGTTGG - Intronic
1120802468 14:88706977-88706999 ATGATTATAAAGGACATTGTTGG - Intronic
1121594309 14:95147896-95147918 TTTATTATAAAGGATATTACAGG + Intronic
1122157470 14:99758823-99758845 TTCATTGTGATGGACAGGGCAGG - Intronic
1122326302 14:100882615-100882637 TTCATCCTAAAGGACATGCTAGG - Exonic
1125091389 15:35796981-35797003 TTCATTAAATATGACATGACAGG + Intergenic
1126060880 15:44781384-44781406 TTCCTTTTAATTGACATGGCTGG - Intergenic
1126268561 15:46784804-46784826 TTAACTATAAAGGCCAAGGCTGG - Intergenic
1127447266 15:59076712-59076734 TTCTTTAGAAAAGGCATGGCTGG - Intronic
1127816009 15:62609397-62609419 TTCATTATAAAGGACATGGCTGG - Intronic
1128272650 15:66325095-66325117 ATCAAAATAGAGGACATGGCCGG + Intronic
1129141885 15:73606122-73606144 TTCATTATCAAAGACACTGCTGG + Intronic
1131758208 15:95589308-95589330 CACATTTTAAAGGACATGTCAGG - Intergenic
1133531663 16:6660795-6660817 GTAATTATAAATGACATGGTAGG - Intronic
1134014045 16:10876309-10876331 TTGAATATAAAGTAGATGGCTGG - Intergenic
1134795602 16:17033195-17033217 TTCATTTTAAACAACATGGTGGG + Intergenic
1134812538 16:17179948-17179970 CTCATTGTTAAGGACATGGGTGG + Intronic
1138070265 16:53985862-53985884 TTCCTTATCAAAGATATGGCAGG - Intronic
1139336216 16:66233314-66233336 CTCATTAAAAAGGCCATGTCTGG - Intergenic
1140093168 16:71853472-71853494 TACCTTATAAAGGACATGCCAGG - Exonic
1140249349 16:73281640-73281662 GTCATAATAAAGGGCATGGGAGG + Intergenic
1140590808 16:76350094-76350116 TTAATTATAAATTACCTGGCTGG - Intronic
1142998094 17:3773189-3773211 TTTATTATAAAGGATATTACAGG + Intronic
1143359909 17:6361045-6361067 TTCATTATAAAGTGCATCCCTGG - Intergenic
1146614700 17:34346257-34346279 TTCTTTAAAAAGGACTTGGGAGG + Intergenic
1147308895 17:39582390-39582412 TTCCTTACAGAGGACATGGTAGG - Intergenic
1153937911 18:9947460-9947482 ATCATTATACAGAACATGACTGG + Intronic
1155145801 18:23082453-23082475 TTAATTATAAAGTACATGGCAGG - Intergenic
1155263454 18:24067821-24067843 TTTATTATAATGGCAATGGCTGG - Intronic
1157788078 18:50504567-50504589 TTCATCTTAAAGGAAATGGTGGG + Intergenic
1158310468 18:56152448-56152470 TGCATTATAAAGCTCTTGGCAGG - Intergenic
1160501425 18:79403000-79403022 TTTGTTGTAAAGGACGTGGCCGG + Intronic
1161414570 19:4138521-4138543 TTGATAATAAAGAACATGGCTGG - Intergenic
1162066355 19:8127681-8127703 TTTATTATAAAGGATATCACAGG + Intronic
1164970700 19:32529992-32530014 TTCATTATAAAGAACAAAACAGG + Intergenic
1166711939 19:44943363-44943385 TTTAACATAAAGTACATGGCCGG - Intronic
1167034521 19:46986535-46986557 GACATCATAAAGGAAATGGCTGG + Intronic
1167235242 19:48310423-48310445 TTCACTGTAAAGGACATCACTGG + Intronic
926802300 2:16669309-16669331 TTCATAGATAAGGACATGGCAGG + Intergenic
928764616 2:34629176-34629198 TTGATTAAAAAGGACAAAGCTGG + Intergenic
929126175 2:38524436-38524458 TTCACTATATTGGCCATGGCTGG + Intergenic
929203063 2:39258226-39258248 TTTAAAATAAAGGATATGGCTGG - Intronic
930553007 2:52859583-52859605 ATAATTATAAAGGATTTGGCAGG - Intergenic
931097262 2:58955283-58955305 TTAGTAATACAGGACATGGCTGG - Intergenic
934740363 2:96716967-96716989 TTCATTATAAAGGACATATTGGG + Intronic
935498149 2:103806527-103806549 TTCAATAAAAAAGAGATGGCCGG - Intergenic
935962175 2:108436492-108436514 TTTATTATAATGGACATTGGTGG + Intergenic
936329678 2:111537028-111537050 TTCACTAAAAAAGACTTGGCAGG - Intergenic
936678997 2:114749354-114749376 GTCTTTATAAAAGACATGGCTGG - Intronic
938590468 2:132731170-132731192 TTCATGATGAAAGACAGGGCTGG - Intronic
938750447 2:134323576-134323598 TTCATCATAAAGGAGACAGCAGG - Intronic
939486773 2:142823468-142823490 TTCAATCTAAAGGATAAGGCAGG + Intergenic
939782910 2:146471997-146472019 TTCATTATGAAAGACAGTGCAGG - Intergenic
940811206 2:158244777-158244799 TTGATTATACAGGCCACGGCTGG + Intronic
942252198 2:174056580-174056602 TTCTTCAAAAAGGAAATGGCCGG - Intergenic
942612826 2:177759467-177759489 TTCATGATAAAGCACTTGTCAGG - Intronic
943712289 2:191110332-191110354 TTCAAAATAAGGGACATGGGAGG + Intronic
944756666 2:202770060-202770082 TTCATTATAAAGTACATGAGAGG + Intergenic
945267410 2:207904099-207904121 TTCCTTATAAAGGAAGTAGCAGG - Intronic
945333935 2:208569801-208569823 ATTATTATTAAGGACATGGCAGG + Intronic
946098028 2:217292193-217292215 TGCATAATAGGGGACATGGCAGG + Intronic
946705825 2:222457922-222457944 TTCATAGGGAAGGACATGGCTGG + Intronic
1169468273 20:5860550-5860572 TTCATTGTAAAGCACATTACTGG - Intronic
1172150156 20:32784746-32784768 TTCCTTATAAAGGACTTGACAGG + Exonic
1175576497 20:60064538-60064560 TCCATGATAAAGGATTTGGCTGG + Intronic
1175972591 20:62694250-62694272 TTTATTATGAAGGACATTGCAGG + Intergenic
1178207423 21:30486198-30486220 TTCATTTTCTATGACATGGCTGG - Intronic
1178233815 21:30819111-30819133 TTCATTATAAATCACATGTAAGG - Intergenic
1179405126 21:41119429-41119451 TTCATTAGAAAGAAGAAGGCAGG - Intergenic
1179592209 21:42416289-42416311 CACATCATAAAGGAGATGGCTGG - Intronic
1182602059 22:31473424-31473446 ATCAATATAAAGGACATTACTGG - Intronic
1183696088 22:39423288-39423310 TTAATTAAAAAGGACAAAGCAGG - Intronic
1185065767 22:48631062-48631084 GTCCTTAGAAAGGACAGGGCGGG - Intronic
950246716 3:11427287-11427309 TTCTTTCTAAAGAACATAGCTGG - Intronic
952078031 3:29722523-29722545 TTTATTATAAAGGACATTTATGG - Intronic
954843784 3:53536054-53536076 TTCATTATAATGTATATGGTTGG + Intronic
955358964 3:58256325-58256347 AACATTATAAAGGACATAGTTGG - Intronic
955425984 3:58790444-58790466 TACATGATAGGGGACATGGCAGG - Intronic
956603136 3:71044723-71044745 TTCATTATAAAAGAAAATGCAGG + Intronic
956892047 3:73623049-73623071 TTGATTAAAAAGGAAATGACTGG + Intronic
957950975 3:87126045-87126067 TTCATTATTAAGGCCATGTGTGG + Intergenic
960137832 3:114123509-114123531 ATCATCAAAAAAGACATGGCTGG - Intergenic
964840951 3:160993200-160993222 TTCATTATAAAGGCAATAGCAGG - Intronic
964946441 3:162231382-162231404 TAGGTTATAAATGACATGGCTGG - Intergenic
966093288 3:176166626-176166648 TACATTGTAAAAGACATGGTAGG - Intergenic
966663940 3:182449602-182449624 GTCATTATAAAGGATATTGCAGG - Intergenic
970148894 4:13068472-13068494 TTCATTTTTAAGCACATGGGTGG + Intergenic
971127242 4:23767521-23767543 ATCAATATAAAGGACATTGATGG - Intronic
971465541 4:26955437-26955459 ATCATAATAATGGACATAGCAGG - Intronic
971891125 4:32523765-32523787 GTGATTATAAAGGAAATGACTGG - Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
973556165 4:52085404-52085426 TACCTTATAAAGGGCATTGCAGG + Intronic
973995380 4:56453338-56453360 TACATTATAAAGGGGATAGCAGG - Intronic
980266819 4:130526624-130526646 TTCATTATTAAGGACAAGAAAGG + Intergenic
983811584 4:172068692-172068714 TACAATATAAAGGAGAGGGCTGG - Intronic
984488644 4:180403577-180403599 TTCATTCTAATGGGCAGGGCAGG - Intergenic
984753136 4:183297943-183297965 TTCAACAGAAAGGCCATGGCAGG + Intronic
985224675 4:187747385-187747407 TTCATTACAATGGACACTGCAGG - Intergenic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
990397291 5:55395107-55395129 TAAAATATAAAGGAAATGGCTGG + Intronic
990620961 5:57557874-57557896 TTCAGAAAAAAGGACAGGGCTGG + Intergenic
993459086 5:88160855-88160877 GTCATTATAAAGGACATTATTGG + Intergenic
993520397 5:88892394-88892416 TTCAGCATAAAGCACAGGGCTGG + Intronic
994501531 5:100584803-100584825 TTCATTATTCTGGAAATGGCAGG + Intronic
994868522 5:105313047-105313069 TTCATTCTACATGACATGGATGG + Intergenic
995603689 5:113827507-113827529 ATCATTACAAAGTACATGGGTGG + Intergenic
996186363 5:120481038-120481060 TTCAATATAAAGTACATGGCAGG + Intronic
997335342 5:133104779-133104801 TTCATTATGACTTACATGGCAGG + Exonic
997812473 5:136985075-136985097 ATCATTACAAGGGACATGGCTGG + Intronic
998117318 5:139548000-139548022 TTCATTATAAATTTAATGGCTGG + Intronic
998510847 5:142712838-142712860 GTCATTTTAAAGGACATTTCTGG + Intergenic
1004300081 6:14449717-14449739 TTTATTCTAAAGGGCATGGGGGG + Intergenic
1004745485 6:18504774-18504796 TTCTTTACAAAGGACAGGGCTGG + Intergenic
1005787060 6:29254792-29254814 TTCATTATAAAGTATTTGTCAGG - Intergenic
1006006652 6:31007925-31007947 GTCATCATAAGGGACATGTCGGG - Intergenic
1008187706 6:48414561-48414583 TACATTTTAACGGAAATGGCTGG - Intergenic
1011958191 6:93051193-93051215 TTCATTTTAAAGGACTTGCAGGG + Intergenic
1013279364 6:108621392-108621414 GTCATTCTTAAGGCCATGGCAGG + Intronic
1015598107 6:134885697-134885719 TTCATTATAAAGGTTTGGGCAGG + Intergenic
1015980729 6:138835800-138835822 GTGATTATAAAGGACATTGCTGG - Intronic
1016546646 6:145231770-145231792 TTCATTGTTAAGAACAAGGCAGG - Intergenic
1017508987 6:155095351-155095373 TTCATTGTGAAGAACTTGGCTGG + Intronic
1017936594 6:159010966-159010988 TTCATTTAAAATGACAGGGCTGG + Intergenic
1018636507 6:165864159-165864181 TTTCTTATAAAGGATCTGGCTGG - Intronic
1020097032 7:5374934-5374956 TTCCTCATAAAAGACATGCCTGG - Intronic
1020493371 7:8817232-8817254 GGTATTATAAAGGACATAGCTGG + Intergenic
1021551798 7:21878903-21878925 CCCATTTTAAAGGACAAGGCAGG + Intronic
1021601245 7:22365998-22366020 TTGATTAGAAAGGACATTACAGG - Intergenic
1024118871 7:46217428-46217450 TTCATTAAAAAGAACACGGCTGG - Intergenic
1027478327 7:78661916-78661938 TCCAGTATAAAGGACACAGCAGG + Intronic
1030584542 7:111401552-111401574 TTCTTTGGAAAGGACATGACTGG - Intronic
1030662019 7:112230021-112230043 TGCATTATAAAGGACCTTGTGGG + Intronic
1030681831 7:112442370-112442392 ATCATTATAGAGTACGTGGCAGG + Intronic
1030946574 7:115729535-115729557 GTGATAATAAAGGACATTGCAGG + Intergenic
1032531541 7:132624785-132624807 TTGATTCTAAAGGTCGTGGCAGG - Intronic
1032554268 7:132815403-132815425 TTAATTACAAAGGAAATGGCAGG + Intronic
1035001952 7:155619607-155619629 TTGAGAATAAAGGACTTGGCTGG - Intronic
1036472990 8:9067337-9067359 TTTATTATAAAGGTCATGATGGG + Intronic
1037023992 8:14009512-14009534 TCCATTATCACTGACATGGCAGG + Intergenic
1037190059 8:16113794-16113816 TTAAGTATAAAGGACTTGGAAGG + Intronic
1037763312 8:21756477-21756499 TTCATTATGAGGGAGATGGTGGG + Intronic
1041173390 8:55168399-55168421 TTCATTCTAAAGTACATGAGAGG + Intronic
1041412598 8:57573258-57573280 GTAATTGTAGAGGACATGGCTGG + Intergenic
1042035538 8:64529509-64529531 TTCATCATAAATCACATTGCTGG - Intergenic
1045494045 8:102693383-102693405 TTTATTAAAAAGGGCATAGCAGG + Intergenic
1045683209 8:104684675-104684697 TTCATTATAAATTACCTGGTGGG - Intronic
1046659775 8:116937379-116937401 TTCACTATAAAGTACCAGGCGGG + Intergenic
1046698713 8:117375357-117375379 ATCATTAGAAAGGAAATGTCAGG + Intergenic
1047250143 8:123175752-123175774 TTCAAAAGAAAGGAAATGGCTGG - Intergenic
1049017309 8:139929908-139929930 TCCATTTTACAGGACATGGAAGG - Intronic
1049957843 9:709914-709936 TTCATTATAAAAGACACGAAAGG - Intronic
1050568055 9:6908000-6908022 TTCCTTACAAAGGACTTTGCAGG - Intronic
1051488957 9:17639160-17639182 TTTATTTTAAAAGACATGGAAGG + Intronic
1052841426 9:33294564-33294586 TTCATCATAAGGGACCTGCCTGG - Exonic
1054912144 9:70464713-70464735 TTTATTATAAAGGATATTACAGG + Intergenic
1055183944 9:73427425-73427447 TTCTTTAAAAACTACATGGCAGG + Intergenic
1057093421 9:92281988-92282010 TTAACTATAAAGGACACTGCTGG + Intronic
1057323108 9:94032281-94032303 TTCAGTATCAGGGACAGGGCTGG + Intronic
1057711727 9:97451586-97451608 TTTACTATGAAGGATATGGCTGG - Intronic
1058030677 9:100194078-100194100 ATCATTATAAATGTAATGGCTGG + Intronic
1060014029 9:120070762-120070784 TTCATTAAAAAGGGAATGGTTGG + Intergenic
1061756269 9:132814637-132814659 TTCTTTGAAAAGGAGATGGCAGG - Exonic
1062310411 9:135932676-135932698 TTCATTTTAAAAAACATGACCGG - Intergenic
1185829236 X:3283636-3283658 TTCATTATGACTGACATGCCAGG + Intronic
1187272293 X:17790320-17790342 TTCTTTATAAATGACATGCATGG - Intergenic
1187355937 X:18571682-18571704 TTCATCATAAAGTGCAGGGCAGG + Intronic
1191684600 X:63877071-63877093 TTCATTAAAAAAGACATAGAAGG + Intergenic
1193371596 X:80704933-80704955 AGCATTATAAATGACATGGCTGG + Intronic
1194440106 X:93921700-93921722 TTCCTTATAAAAGACATCACTGG + Intergenic
1195615335 X:106907402-106907424 TCAATTATAAAGGACTAGGCTGG + Intronic
1196023284 X:111012696-111012718 TTAAGTATCAAGGACATGGTGGG + Intronic
1196253541 X:113489182-113489204 TTCTTTATAAAGGCCATTTCTGG - Intergenic
1198522499 X:137467233-137467255 TTCGCTATAAAGGACATTACTGG - Intergenic
1198976983 X:142347134-142347156 TTCATTATAATGGACATTACTGG - Intergenic
1199535668 X:148900117-148900139 ATCATTATAAAGAAAATGGCTGG + Intronic
1200006332 X:153087435-153087457 ATAATTAAAAAGGACAGGGCAGG - Intergenic
1200954341 Y:8929383-8929405 GTCATATTAAAGGACATTGCTGG - Intergenic