ID: 1127819581

View in Genome Browser
Species Human (GRCh38)
Location 15:62643313-62643335
Sequence ATGGGGAGCCAGAAGTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 16, 2: 60, 3: 262, 4: 660}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127819577_1127819581 14 Left 1127819577 15:62643276-62643298 CCTTATCTCAAGCTTGGAAAAAC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1127819581 15:62643313-62643335 ATGGGGAGCCAGAAGTGAGAAGG 0: 1
1: 16
2: 60
3: 262
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127819581 Original CRISPR ATGGGGAGCCAGAAGTGAGA AGG Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900803787 1:4754418-4754440 GTGGGTAGCCAGAAGGGAAAGGG - Intronic
901899440 1:12346137-12346159 TTGGGTAGCCAGTAGTGAGGTGG + Intronic
903057004 1:20643057-20643079 ATGAGGAGCCAGAGGTGAGCAGG - Intronic
903293026 1:22326597-22326619 AAGGGGACCCAGAAGTGTGAGGG - Intergenic
903503745 1:23817879-23817901 ATTGGGAGACAGAAGCGAGGAGG - Intronic
904041213 1:27586288-27586310 AGGAGGAGCCACAGGTGAGATGG + Intronic
904500711 1:30911266-30911288 ATGAGGAGCCAGATGTCAGCTGG + Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
905372296 1:37489425-37489447 ATTGGGAGGCTGAGGTGAGAGGG + Intergenic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
905873266 1:41416783-41416805 AGGGGAAGCCACAAGTGTGAGGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906318864 1:44804622-44804644 ATGGGGAGGCAGAGGTCAGAGGG - Intronic
906328040 1:44860774-44860796 ATGGGCAGCTGGAAGGGAGAAGG + Intronic
906693821 1:47810904-47810926 ATGGGCAGGCAGAAGGGAAAGGG - Intronic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908756781 1:67476071-67476093 CTAGGGAGCCAAAAATGAGATGG + Intergenic
908892116 1:68860041-68860063 ATGCGGAACCAGAAGGGCGATGG + Intergenic
908986742 1:70032871-70032893 GTGAGGAGACAGAAATGAGAGGG - Intronic
909486591 1:76180779-76180801 ATGGGGAGCTAGACAGGAGATGG - Intronic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909774501 1:79467101-79467123 ATGTGGAGGCAGGTGTGAGAAGG + Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
909920946 1:81379546-81379568 TAGGGGAGCCAAAAGGGAGATGG + Intronic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
910841308 1:91564670-91564692 ATGAGGTGACAGAAGTGAGTGGG + Intergenic
911376730 1:97060780-97060802 ATGGGGACCCAGAGGTGAATTGG - Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911536474 1:99106208-99106230 AAGGGGAGGGAGAAGTGAGAAGG + Intergenic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912341302 1:108918543-108918565 ATGGGAAACCAGAAGAGAGCTGG + Intronic
912753826 1:112308076-112308098 ATGGGAAGCCTGAGGTCAGATGG - Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913171446 1:116235930-116235952 TTGAAGAGCCAGAAGTGGGAAGG - Intergenic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914214604 1:145613892-145613914 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914466546 1:147934282-147934304 ATGGGGAGGCTGAAGTGGAAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914780370 1:150780320-150780342 TTGAGGGGCCAGAAGTGGGAGGG - Intergenic
914818852 1:151084152-151084174 TTAGGGAGGCAGAAGTGGGAGGG - Intronic
916045655 1:160998342-160998364 ATGGGAAGACAGAAGAGAGTGGG + Exonic
916094746 1:161339288-161339310 CTTGGGAGACTGAAGTGAGAGGG - Intronic
916192112 1:162189909-162189931 ATTGGGAGGCAGCAGTGAGCTGG + Intronic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916399424 1:164430081-164430103 ATGTGAGGCTAGAAGTGAGAAGG + Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
917476615 1:175374268-175374290 ATGGGGATCTAGTGGTGAGAAGG - Intronic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918384028 1:183986897-183986919 GTGGGGAGCCTGGAGTGGGAGGG - Intronic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919065603 1:192689515-192689537 ATGGGGAGGCAGAGATGAAATGG - Intergenic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921084914 1:211780384-211780406 AAGGTGAGCGAGAACTGAGAGGG + Intronic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921891011 1:220353491-220353513 ATGGGGAGCCACAAGCGGTATGG - Intergenic
922223761 1:223627926-223627948 GTGGGGAGGCAGACGTGGGAGGG + Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1062841101 10:672481-672503 CTGGGGAGCCAGAGATGAGCAGG + Intronic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1063929407 10:11014197-11014219 ATGACGAGCCAGAAATGAGAAGG + Intronic
1063973532 10:11397668-11397690 GTGGGGAGCATGAAGTGAGAAGG - Intergenic
1064795817 10:19010040-19010062 ATGGGGAGCCAGAAGAGGTATGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1066212336 10:33252229-33252251 TGGGGGAGCCGGAAGGGAGATGG - Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1068134677 10:52940128-52940150 TGGGGGAGCCGGAAGGGAGATGG - Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068607924 10:59026274-59026296 TGGGGGAGCCAGAAGGTAGATGG - Intergenic
1069209080 10:65733605-65733627 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1069779556 10:70946116-70946138 AGGGGTATCCAGAAGTGAGGTGG + Intergenic
1070643775 10:78187351-78187373 TGGGGGAGCAAGAAGTCAGAAGG - Intergenic
1070970803 10:80565676-80565698 ATGGGGAGGCAAAAGATAGAAGG - Intronic
1070986705 10:80695804-80695826 ATGAGGAGACTGAAATGAGATGG - Intergenic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071064699 10:81616818-81616840 AACGGGAACCAGAAGTGAGCAGG + Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071486850 10:86107872-86107894 TGGGGGAGCAAGAAGGGAGATGG - Intronic
1072139673 10:92578317-92578339 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1073428435 10:103470658-103470680 ATGGGGAGTTAGCAGGGAGAAGG - Intergenic
1073435375 10:103512993-103513015 ACAGGGAACCAGAAATGAGAAGG - Intronic
1073750896 10:106526144-106526166 AAAAGGAGTCAGAAGTGAGATGG - Intergenic
1073805133 10:107089545-107089567 ATGAGGATACAGCAGTGAGAAGG - Intronic
1074259507 10:111837886-111837908 ATAGGAAGCCAAAAGTGGGAGGG - Intergenic
1074606331 10:114972080-114972102 AAGGAGAGCAAGAATTGAGAGGG - Intronic
1074803719 10:117027326-117027348 AGCAGGAGCAAGAAGTGAGAGGG - Intronic
1074858559 10:117491772-117491794 TTGGGGAGCCAGCAGTAAAAAGG - Intergenic
1075818488 10:125284930-125284952 TTGTGGAGCCACAAGAGAGAAGG - Intergenic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1077471132 11:2761134-2761156 TGGGGGAGCAAGAAGGGAGATGG + Intronic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1077887831 11:6399151-6399173 GTGGGCATCCTGAAGTGAGAAGG - Intronic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078427002 11:11260075-11260097 GTGGGGAGCCAGAGGAGTGAAGG - Intergenic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079318470 11:19430149-19430171 CTAGGGAGCCAGAACTGAGAGGG - Intronic
1080792599 11:35535259-35535281 ATCAGGAGCCTGAAGTGAAATGG + Intergenic
1081061354 11:38481701-38481723 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081492191 11:43577596-43577618 ATGGGGGGCATGAAGTGGGAGGG - Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082749764 11:57003130-57003152 ATGGGGAGCCGGAAAGGCGATGG + Intergenic
1083139142 11:60707244-60707266 AAGAGGATGCAGAAGTGAGAAGG + Intronic
1083588866 11:63880646-63880668 ATGGGCAGCAGGAAGTGTGAAGG + Intronic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084365055 11:68692413-68692435 ATGGTGAACAGGAAGTGAGAAGG - Intergenic
1084480820 11:69419061-69419083 ATGGGGAGCCTGAAGTGTGCGGG + Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1084927041 11:72522278-72522300 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1084944832 11:72632874-72632896 AGGGGGAACCAGAAGTTAGGTGG - Intronic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1085762574 11:79255016-79255038 ATGGGAAGCCCAAAGTGAGAGGG + Intronic
1086001851 11:81993082-81993104 TAGGGGAGCCGGAAGGGAGATGG - Intergenic
1086596147 11:88573656-88573678 ATGGGGATACAGAACTGACAAGG + Intronic
1086917366 11:92546480-92546502 ATGAGGAGAAAGAAGTAAGAAGG + Intronic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087461946 11:98456760-98456782 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087788722 11:102384736-102384758 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1087816479 11:102664242-102664264 TGGGGAAGCCAGAAGAGAGATGG - Intergenic
1087934196 11:104013193-104013215 ATGGGGAGCAGGAAAAGAGATGG - Intronic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1089031044 11:115329807-115329829 ATAGGGAGCCGGAAAGGAGATGG + Intronic
1089450496 11:118592167-118592189 TTGGGGAGGCTGAGGTGAGAGGG - Intronic
1090124294 11:124069839-124069861 ATGGGGAGCCAGAAGGGGAGCGG + Intergenic
1090498844 11:127242013-127242035 AGGGGAAGCCAGGACTGAGAGGG - Intergenic
1090818984 11:130323962-130323984 ATGGTGAGTCAGAAGTCAGAAGG - Intergenic
1092236876 12:6815965-6815987 ATGTGGAGGCAGCAGGGAGATGG - Intronic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093184664 12:16006205-16006227 ATTGGGAGCAAGAGGGGAGAGGG - Intronic
1093348953 12:18072635-18072657 ATGGGGAGCCAGAAGGGGAGTGG + Intergenic
1093503274 12:19836359-19836381 TGGGGAAGCCAGAAGTGAGATGG - Intergenic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1093857969 12:24128561-24128583 GTGGTGAGGCAGATGTGAGAAGG + Intergenic
1094111395 12:26866458-26866480 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094261780 12:28508629-28508651 ATGTGGAGCCTGAAGTGACCAGG + Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1094673766 12:32597752-32597774 ATGGGCAGACAGAGGTGAGGGGG + Intronic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096054990 12:48642947-48642969 ATGGTGTGCCAGAACTGTGATGG - Intergenic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1097190913 12:57219248-57219270 ATGGGAAGCCTGGAGTGAGGAGG - Intronic
1097219279 12:57437743-57437765 ATGAGGGGCCAGAAATGGGAAGG - Intronic
1097787522 12:63778234-63778256 ATAGGGAACCAGACCTGAGAAGG - Intergenic
1098034252 12:66286306-66286328 AGGGAGAGCAGGAAGTGAGAAGG + Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098396849 12:70028581-70028603 ATGGGGAGCTAGAAGGGGTATGG + Intergenic
1098830105 12:75351229-75351251 ATGGGGAGAAAGAACTGAGTTGG + Intronic
1098908686 12:76187662-76187684 CTGGGGAGACAGAGGTGAGGAGG - Intergenic
1099460024 12:82910649-82910671 ACGGAGGGCCAGAAGGGAGATGG + Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099890442 12:88583182-88583204 AGGAGGAGACAGAACTGAGAGGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1102029851 12:109733968-109733990 TTAGGGAGGCTGAAGTGAGAAGG + Intronic
1102086925 12:110149613-110149635 TAGGGGAGCCCGAAGGGAGATGG + Intronic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230290 12:111257385-111257407 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230297 12:111257404-111257426 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230304 12:111257423-111257445 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230311 12:111257442-111257464 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230318 12:111257461-111257483 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102230325 12:111257480-111257502 AGGGGGAGGAAGAAGTGGGAGGG - Intronic
1102243827 12:111342371-111342393 CTTGGGAGGCCGAAGTGAGAGGG + Intronic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102476782 12:113193884-113193906 ATGGGAAGGCAAAAGAGAGATGG - Intergenic
1103166251 12:118773088-118773110 ATGGGGAGCGTGAAGGGGGATGG + Intergenic
1103578866 12:121899509-121899531 ATGTGGAGCTAGAGGTGAGAAGG - Intronic
1103621648 12:122190555-122190577 ATTTGGAGACAGAAGTGATAGGG + Intronic
1103674408 12:122644378-122644400 TAGGGGAGCCAGAAAGGAGATGG + Intergenic
1103967194 12:124647290-124647312 CTGGGGAGGCTGAGGTGAGAAGG - Intergenic
1104144215 12:126017416-126017438 AAAGGGAGGCAGAAGAGAGAGGG - Intergenic
1104168824 12:126259996-126260018 ATGGGGTACCACAAGTGACAAGG - Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1105429768 13:20326153-20326175 CGGGGGAGCCAAAAGAGAGATGG - Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1107798519 13:44080274-44080296 TTGGGGGGCCAGAGGTGAAATGG + Intergenic
1107835006 13:44405914-44405936 AGAGGCAGCCAGAGGTGAGAGGG + Intergenic
1108218994 13:48214526-48214548 ATAGGAAGTCAGATGTGAGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108543229 13:51464129-51464151 CTGGGGAGCCATAAATTAGAAGG + Intergenic
1109075745 13:57832471-57832493 ATGAGGAGACAGAAGGGAGATGG - Intergenic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109152430 13:58860916-58860938 TCAGGGAGCCAGAAGGGAGATGG + Intergenic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109651294 13:65330751-65330773 TGGGGGAGCAAGAAGCGAGATGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109924678 13:69120508-69120530 AATGGAAGCCAGAAGTGAGCAGG + Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110835176 13:80074674-80074696 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1110860703 13:80341834-80341856 AAGGGGAGCGGGAAGTGAGGTGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111184859 13:84720422-84720444 ATGGGGAGCCAGGAGGGAGATGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111217225 13:85159776-85159798 TGGGGGAGCCAGAACGGAGATGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1111406239 13:87810890-87810912 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112605394 13:100899863-100899885 CTGGGCAGACAGAAGTGTGAAGG + Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113973776 13:114211302-114211324 CTGGGGAGCATGAAGTGGGAGGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114756487 14:25266089-25266111 AATGGAAGCCAAAAGTGAGAAGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116031597 14:39579460-39579482 AACAGGAGTCAGAAGTGAGAAGG - Intergenic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1117046235 14:51816366-51816388 ATGGGAAGCCGGAAGAGGGATGG + Intergenic
1117598650 14:57350703-57350725 TTTGGGAGGCAGAGGTGAGAGGG + Intergenic
1118542676 14:66846186-66846208 ATGGGGAACCTCAATTGAGAAGG - Intronic
1118733403 14:68685030-68685052 ATGGTGAGCCAGCGGTGGGAAGG + Intronic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119519449 14:75275255-75275277 CTGGGGATCCAAAAGTGAAAAGG - Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1119702250 14:76762946-76762968 ATGAGGAGCCAGAAGAGGAAGGG + Exonic
1120081425 14:80221130-80221152 ATAGGAAGCAAGAAGTGAGTAGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1121050136 14:90815042-90815064 CTGGGTAGTCTGAAGTGAGAAGG + Intronic
1121184479 14:91954517-91954539 TTGGGGAGACTGAGGTGAGAGGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1122328705 14:100898771-100898793 TTGGGGAGCCCAAAGTTAGATGG + Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122624055 14:103075288-103075310 AGGTGGAGACGGAAGTGAGAGGG - Intergenic
1122744028 14:103887578-103887600 ATGAGGGGGCAGAGGTGAGAAGG - Intergenic
1122920071 14:104876406-104876428 GGGAGGAGCCAGAACTGAGAGGG - Intronic
1122998566 14:105279099-105279121 CTCGGGAGGCTGAAGTGAGAGGG + Intronic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1125570267 15:40711683-40711705 ATGGGAAGGCATAAGTTAGAAGG + Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126430697 15:48580734-48580756 CTGGGTAGCCTGAAGTGACATGG - Intronic
1126709386 15:51440853-51440875 AAGGGGAGGGAAAAGTGAGAAGG - Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127511568 15:59647198-59647220 CTGGGGAGGCTGAGGTGAGAGGG - Intronic
1127725531 15:61745597-61745619 AGTGGGAGCCAGGAGGGAGAAGG - Intergenic
1127807707 15:62536275-62536297 ATGGGCAGCCAGGCCTGAGAAGG + Intronic
1127819581 15:62643313-62643335 ATGGGGAGCCAGAAGTGAGAAGG + Intronic
1127831341 15:62754119-62754141 ATGGGGTGCCAGAAGGCAAAAGG + Intronic
1127840434 15:62827008-62827030 TTGTGGAGCCAGTTGTGAGAAGG + Intronic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1130040104 15:80399464-80399486 AAGGGGAGCTGGAAGTGAAAGGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1130942517 15:88523412-88523434 AAGGGGAGACAAGAGTGAGAGGG - Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131605496 15:93899280-93899302 ATAGGGACCCACCAGTGAGATGG - Intergenic
1133325752 16:4941178-4941200 ATGGGGAACGAGAAAGGAGAGGG - Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134421071 16:14090480-14090502 TTGGGGATCCAGAGGTGAGTGGG + Intronic
1135239585 16:20792636-20792658 ATGGGGTGACAGAAGTCAGCTGG + Intronic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135778822 16:25280713-25280735 AGGGGGAGACAGTAGTGAGGAGG + Intergenic
1136403895 16:30032219-30032241 ATGGGAGGCCAGAAGTCAAAGGG - Intronic
1136591186 16:31218742-31218764 CTTGGGAGACTGAAGTGAGAGGG + Intronic
1137553794 16:49457494-49457516 TTGGGGAGACAGAAGTGAACAGG - Intergenic
1137563897 16:49521558-49521580 ATGGGGAGACAGCAGTGGCATGG + Intronic
1137853828 16:51773402-51773424 CGGGGGAGCAAGAAGGGAGATGG - Intergenic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1138628827 16:58277017-58277039 ATGGGGTGACAGGAGTGGGATGG + Intronic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1140044817 16:71433256-71433278 ATGGTGAGCCAGAGGAGAGGAGG - Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1141035093 16:80619595-80619617 ATGGAAAGGCAGTAGTGAGAGGG + Intronic
1141535568 16:84677520-84677542 ATGAGGAGCCAGAAGTGACCAGG - Intergenic
1142300954 16:89257507-89257529 TGGGGGAGCCGGAAGGGAGACGG + Intergenic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1142904739 17:3034221-3034243 GTGGGAAGCCAGGAGTGAGAAGG + Exonic
1143158224 17:4852528-4852550 GTGGAGACCCAGGAGTGAGAAGG + Intronic
1143600663 17:7943698-7943720 ATGGAGAGCCAGAAGTGCCTGGG + Intronic
1144125047 17:12195656-12195678 ATGGGGAGTCGGAAGTGAGTGGG + Intergenic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1145289171 17:21529622-21529644 ATGGGGAGCTGGAAGTGGGGAGG - Exonic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1145377908 17:22368520-22368542 TTTGGGAGCCTGAAGTGGGAGGG + Intergenic
1145831908 17:27923204-27923226 ATGAGGAGCAAGAAGAGAGGTGG + Intergenic
1146065301 17:29630359-29630381 AAGGTCAGCCAGAAGTCAGAGGG - Exonic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146809580 17:35892466-35892488 AAGGACAGCCAGAAGGGAGAAGG - Intergenic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147580657 17:41625557-41625579 TTGGGGAGCCTGGAGTGGGAAGG - Intergenic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148182129 17:45613762-45613784 TTTAGGAGCCAGAATTGAGAGGG - Intergenic
1148266730 17:46231934-46231956 TTTAGGAGCCAGAATTGAGAGGG + Intergenic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148738618 17:49879575-49879597 AGGGGGAGGCAGAAGTGAGGAGG - Intergenic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149723132 17:58865461-58865483 TTGGGGAGGCAGAGGTGAGGCGG + Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150260422 17:63785517-63785539 TTAGGGAGGCAGATGTGAGAGGG + Intronic
1150651890 17:67015924-67015946 TGGGAGAGCCAGGAGTGAGAGGG + Intronic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151068816 17:71184857-71184879 ATGGTGAGCAAGGATTGAGAAGG - Intergenic
1151398883 17:73842882-73842904 ATGGGCAGCCAGAGGGGAGCGGG - Intergenic
1151765393 17:76131017-76131039 ATGGGGAGAAAGAAAGGAGAGGG - Intergenic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1152335237 17:79696870-79696892 TGGCGGAGCCAGAAGGGAGATGG - Intergenic
1153682365 18:7512675-7512697 ATGGGAAGCAAGAAGAGAGGAGG - Intergenic
1153773756 18:8435286-8435308 GATGGGAGCCAGAAGGGAGATGG - Intergenic
1153842753 18:9021945-9021967 CTGGGGAGGCTGAAGTGGGAGGG - Intergenic
1153896327 18:9565302-9565324 ATAGGGAGACAGGAGAGAGATGG - Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1156439266 18:37167445-37167467 ATGGGGTGTCAGAAGGGGGATGG + Intronic
1156440069 18:37176480-37176502 GTGGAGAGCCAGAAGTGAAATGG - Intronic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1156691081 18:39707959-39707981 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1157014750 18:43698679-43698701 AAGGGGAGCCACAGGTGAGTGGG + Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157810985 18:50695668-50695690 CTGGGGAGCCGAGAGTGAGAAGG + Intronic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1160466027 18:79077358-79077380 CTGGGGAGCCAGCAGTCACATGG - Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1161533505 19:4804332-4804354 ATGGGGATGCAGAAGTAATAGGG - Intergenic
1161778093 19:6274765-6274787 ATGGTTTCCCAGAAGTGAGACGG - Intronic
1161992008 19:7689512-7689534 ATGGGGAACCTGGGGTGAGAAGG - Intronic
1162004280 19:7767349-7767371 ATGGGGATACAGATGTGAGAGGG + Intronic
1162085177 19:8244508-8244530 AAGTGGAGCCAGAAAAGAGAAGG - Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162451932 19:10760281-10760303 TTAGGGAGGCCGAAGTGAGAGGG - Intronic
1162639893 19:11999998-12000020 TAGGGGAGCCAGAAGCGAGATGG - Intergenic
1163019027 19:14472949-14472971 ATGGGGATCCAGATGAGAAACGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163579505 19:18130005-18130027 TTTGGGAGCCCGAAGTGGGAGGG + Intronic
1163617087 19:18335764-18335786 TGGGGGAGCGAGAAGGGAGATGG - Intergenic
1163698052 19:18773942-18773964 ATGGGGAGCTCCAAGGGAGAGGG + Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1164596023 19:29531000-29531022 ATGGGGGGCGGGATGTGAGAAGG + Intronic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1167027656 19:46932917-46932939 ATTGGGAGCGATAAGAGAGACGG - Intronic
1167337665 19:48896598-48896620 ATGGGAAGACAGAAGTGAGGTGG + Intronic
1168102036 19:54146424-54146446 CTGGAGAGCCTGAATTGAGATGG + Intronic
1168115934 19:54221389-54221411 AAGAGGAGCCAGGACTGAGAGGG + Intronic
1168118917 19:54241137-54241159 AAGAGGAGCCAGGACTGAGAGGG + Intronic
1168186883 19:54705704-54705726 ATGGGGAGCCACAGGTGGAAAGG + Intergenic
1168232478 19:55042051-55042073 AGGGGGAGTCAGAGGTGAGGGGG - Intronic
1168388535 19:55986915-55986937 TTGAGCAGCCAGAAGGGAGAGGG - Intronic
1168709398 19:58490051-58490073 CTGGGGAGGCTGAAGTGGGAGGG - Intronic
925000755 2:401091-401113 AAGAGGATCCGGAAGTGAGAAGG + Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925424759 2:3739637-3739659 TGGCGGAGCCAGAAGGGAGACGG - Intronic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
925806759 2:7658566-7658588 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926781568 2:16477405-16477427 ATGGAGACCAAGAAGCGAGATGG - Intergenic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927853193 2:26512689-26512711 GTGGGGAGCAAGAGCTGAGAAGG + Intronic
927939797 2:27096300-27096322 CTGGGGCGCCAGAAGTGAGGGGG + Intronic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
928985537 2:37177553-37177575 ATAGGGAGACAGAAGTCAAAAGG + Intronic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930606042 2:53494119-53494141 GTGCAGAGCCAGAAGTGAGCTGG + Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931788957 2:65646357-65646379 GTGGGGATCCAGTAGAGAGATGG + Intergenic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
932839900 2:75072414-75072436 TTGGAGACCCAGATGTGAGAGGG + Intronic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
933140894 2:78792221-78792243 ATGGGGAGCCAGATGAGGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
933633347 2:84680907-84680929 ATGGGGAAGCTGAAGTGTGAGGG + Intronic
933966724 2:87435983-87436005 AAGGGGACACAGAAGTGACAAGG - Intergenic
934583599 2:95468131-95468153 ATGGTGTGCCAGAAGGGGGATGG + Intergenic
934595853 2:95608583-95608605 ATGGTGTGCCAGAAGGGGGATGG - Intergenic
934785222 2:97000223-97000245 GTGGGGAGGCTGAAGTGGGAGGG - Intronic
934786921 2:97016905-97016927 ATGGTGTGCCAGAAGGGGGATGG + Intronic
934858402 2:97743216-97743238 GTGGAGAGCCAGAGGTGGGAGGG - Intergenic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935227058 2:101061821-101061843 ATGGGGAGCCTGAAGGGCCAGGG - Intronic
935332241 2:101985712-101985734 AGGGGCAGCCAGAAGGCAGATGG + Intergenic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935876725 2:107515371-107515393 ATGGGGAGCCATTAGGGACATGG + Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
936582604 2:113716496-113716518 ATGAGGAGGCAGAACTGATATGG + Intronic
936607549 2:113973360-113973382 CTAAGGAGGCAGAAGTGAGAAGG + Intergenic
936647544 2:114389053-114389075 ATGGGGAGCTGGAAATGGGATGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
938030239 2:127986008-127986030 GGGGGAAGCCAGAAGGGAGATGG - Intronic
938305169 2:130248310-130248332 ATGAGGCCCCAGAAGGGAGAAGG - Intergenic
938448847 2:131398897-131398919 ATGAGGCCCCAGAAGGGAGAAGG + Intergenic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
939451164 2:142376416-142376438 ATGGGGAGCCAAAAGGTGGATGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939649722 2:144745727-144745749 TGGGGGAGCCAGAAGTGAGATGG - Intergenic
939829376 2:147053937-147053959 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
940134452 2:150420764-150420786 ATCGGAACCCAGAAGTGAGCTGG + Intergenic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942130380 2:172872919-172872941 ATAGAAAGCCTGAAGTGAGAGGG - Intronic
942480662 2:176384877-176384899 ATGGGGAAACAGAAGTGATAGGG + Intergenic
942504601 2:176628338-176628360 CTGGGACGCAAGAAGTGAGAAGG + Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943343796 2:186713141-186713163 CTGGAGAGCATGAAGTGAGAGGG + Intronic
943521016 2:188949399-188949421 ATGAGGAGCTGGAAGTGGGAAGG - Intergenic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
943838878 2:192552264-192552286 TTGGGGAGCCAGAAGAGGGATGG + Intergenic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
944962599 2:204892086-204892108 AGGGGGAGCCAGAGGGGACAAGG + Intronic
945795436 2:214357059-214357081 AGTGGGAGCCAGAAGACAGAAGG - Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947808259 2:232983172-232983194 TTGGGGAGCCAGCAGTGGGGAGG + Intronic
948051612 2:234983106-234983128 GTGGGGATACAGAAGTGAGCAGG + Intronic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948966604 2:241386461-241386483 ATGGGGAGACAGATCTGAGCCGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170557787 20:17529428-17529450 ATTGGGAGACAGAGGTGGGAAGG - Intronic
1170612126 20:17923337-17923359 CAGGGGAGCGAGAAGTGATATGG - Intergenic
1170984042 20:21242223-21242245 ATAGGGAGTCAGAAGTGGGAAGG + Intronic
1171025640 20:21628265-21628287 CTGGCAAGCCAGAAGTAAGAGGG - Intergenic
1171099250 20:22367126-22367148 ATGGGAAGGCACAAGTGAGGAGG - Intergenic
1171182448 20:23100812-23100834 ATGGGGAGCCAGTAGTGATGGGG + Intergenic
1171182453 20:23100830-23100852 TGGGGGAGCCAGAAGTGATGGGG + Intergenic
1171182482 20:23100928-23100950 ATGGGGAGCCAGTAGTGATGGGG + Intergenic
1171384211 20:24756762-24756784 TGGGGGAGCCACAAGGGAGACGG + Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1172526872 20:35605112-35605134 CTGGGGTGCCTGGAGTGAGATGG - Intergenic
1172585177 20:36078166-36078188 TTGGGGAGCCAGAAGGGAAATGG + Intergenic
1172800733 20:37574420-37574442 CTGGGGAGTCAGGACTGAGAAGG + Intergenic
1173940046 20:46903130-46903152 CTGGAGAGCCAGAGGTGAGAAGG + Intronic
1174021749 20:47535852-47535874 ATGGGGAGCCATAAGAGGGATGG + Intronic
1174462674 20:50693888-50693910 TTTGGGAGCCTGAGGTGAGAGGG + Intergenic
1175572143 20:60031693-60031715 TTGGGGGGCCAAAGGTGAGAGGG + Intronic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1176721064 21:10393216-10393238 GTGGGAAGGAAGAAGTGAGAAGG - Intergenic
1176980493 21:15375897-15375919 ATGGGGAGCTGGAAATGGGATGG - Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177601295 21:23318254-23318276 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1177644806 21:23887434-23887456 TGGGGGAGCCAGAAGACAGATGG - Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178384524 21:32138435-32138457 ATGGGGATCCAGAAGGGGGTTGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179049605 21:37877734-37877756 CTGGAGAGGAAGAAGTGAGAGGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179177996 21:39022491-39022513 ATCGGGAGCCAGAAGCGAGGTGG - Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179918056 21:44490720-44490742 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1180120179 21:45740884-45740906 ATGGGGAGGCAGTAGAGATACGG + Intronic
1180302253 22:11046006-11046028 GTGGGAAGGAAGAAGTGAGAAGG - Intergenic
1180722332 22:17918748-17918770 ATGCGGAGGCTGAGGTGAGAGGG - Intronic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1180969819 22:19809357-19809379 TGAGGGAGCCAGAAGGGAGATGG - Intronic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181610428 22:24007936-24007958 AGGGGGAGGCAGAGGCGAGAGGG - Intergenic
1183053526 22:35285616-35285638 CTTGGGAGGCAGAGGTGAGAGGG + Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183134363 22:35872543-35872565 TGTGGGAGCCAGAAGGGAGATGG + Intronic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183413232 22:37667601-37667623 TTGGGGATTCAGAACTGAGAAGG - Intergenic
1184064072 22:42105963-42105985 ATTGGGAGCCAGAAGCTGGATGG + Intergenic
1184775555 22:46621090-46621112 ATGGGCAGCTAGAAGTGGGGAGG + Intronic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1185075161 22:48679024-48679046 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075228 22:48679216-48679238 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185075239 22:48679247-48679269 ATGGGGAGCCGGGAGAGGGATGG - Intronic
1185075248 22:48679270-48679292 ACGGGGAGCCGGAAGAGGGATGG - Intronic
1185075425 22:48679730-48679752 CTGGGGAGCCAGGAGAGGGATGG - Intronic
1185106384 22:48872171-48872193 ATGGGGAGGCAGGAGGGACAGGG - Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
950552722 3:13676383-13676405 ATCGGGGGTCAGAAGGGAGAGGG + Intergenic
951418254 3:22451190-22451212 TTGGGGAGCCAGAATGCAGATGG + Intergenic
952002986 3:28808611-28808633 ATAGGGAGCCAGAAGGGGGTTGG + Intergenic
952003338 3:28810859-28810881 ATAGGGAGCCAGGAGGGGGATGG + Intergenic
952210108 3:31221984-31222006 ATGTGGGGTCAGGAGTGAGAAGG + Intergenic
952564209 3:34635413-34635435 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
952899470 3:38099966-38099988 CTGGGGAGCCAGAGGAGAGCTGG - Intronic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953583621 3:44179743-44179765 ATGGGGATCAGGAAGTGAGCTGG - Intergenic
953606692 3:44417235-44417257 ATGGGCAGGAAGAGGTGAGATGG - Intergenic
954301757 3:49704069-49704091 ATGGGGTGCCATCAGGGAGAGGG + Intronic
954693583 3:52408976-52408998 ATTGGGGCCCACAAGTGAGAAGG - Intronic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
955480575 3:59385425-59385447 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
956009549 3:64816151-64816173 AGTGGGAGCCTGAAGTGAGCTGG - Intergenic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956733503 3:72217962-72217984 AGGAGGTGCCGGAAGTGAGATGG + Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956973859 3:74557686-74557708 ATGAGAAGCCTGAAGTGACAGGG - Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957902496 3:86513158-86513180 AGGGGGAGCAAAGAGTGAGATGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958632310 3:96700006-96700028 ATGGGGAGTCAGAAGGGATAGGG - Intergenic
958632904 3:96703937-96703959 TGGGGGAGCCTGAAGGGAGATGG - Intergenic
958816571 3:98923331-98923353 ATGGTGAGCAAAAAGAGAGAGGG - Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960415797 3:117383403-117383425 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960647410 3:119902820-119902842 CTTGGGAGCCTGAAGTGGGAGGG - Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961142844 3:124569793-124569815 ATTTGGGGCCAGAGGTGAGAGGG - Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961820532 3:129573514-129573536 ATGGGGAGGGAGGAGTGAGGAGG + Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962075026 3:132072577-132072599 AAGGGAAGCCTGAAGTGGGAAGG + Intronic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
963035902 3:141028615-141028637 ATGTGTAGCAAGAAGGGAGATGG + Intergenic
963065028 3:141256842-141256864 GAGGAGAGCCAGAAGTGGGAGGG + Intronic
963069008 3:141287040-141287062 TTGGGGAGCCGGAAGATAGACGG + Intronic
963996999 3:151721375-151721397 TGGGGGAGCCGGAAGGGAGATGG + Intergenic
964308026 3:155361691-155361713 TGGGGGAGCTAGAAGGGAGACGG + Intergenic
964355364 3:155846787-155846809 ATGGGGAGACAGAGGTGAGAAGG - Intronic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
967428560 3:189355404-189355426 GTGGGGAGATAGAAGTCAGAGGG + Intergenic
968533297 4:1107518-1107540 AGGCGGAGCCTGCAGTGAGATGG - Intronic
968823880 4:2878399-2878421 ATGGGGTGGAAGAAGTGAAAGGG + Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970349605 4:15188821-15188843 ATAGGGTGGCAGAAGAGAGAGGG + Intergenic
970697560 4:18696215-18696237 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
971732059 4:30397138-30397160 ATGGGGAGGCAGCAGTGAGGAGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
971947966 4:33306007-33306029 ATGGGGAGCTAGAAAAGAGATGG - Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973213556 4:47643262-47643284 ATGGGGAACAAAAAGTGAGAAGG + Intronic
973253559 4:48085808-48085830 ATGGGGAGCTGGAAATGGGATGG - Intronic
973339617 4:48990504-48990526 CTGAGGTGCCAGAAGTGAGATGG - Intronic
973728935 4:53804583-53804605 CTGAGGAGCCAGAAGTTGGATGG + Intronic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974303289 4:60098155-60098177 ATGGGGAGCCAGAAGAGGAATGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
976751436 4:88454568-88454590 TGGGGGAGCCAGAAGGGAGTTGG - Intergenic
976848147 4:89513565-89513587 AGGGGGAGACAGAAGAAAGATGG - Intergenic
977031321 4:91888136-91888158 ATTGGAAGACATAAGTGAGATGG - Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
980617190 4:135244265-135244287 ATGGTAAGCCAGAAGTCAGGAGG + Intergenic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982869145 4:160553752-160553774 AAGGGGAGCTAGAAGGCAGATGG + Intergenic
982947779 4:161648041-161648063 TGGGGGAGCCAGTAGGGAGATGG - Intronic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
983717674 4:170805271-170805293 ATGGGAGGCCAGAAGAGAGATGG - Intergenic
984229768 4:177080689-177080711 AAGGGGAGTACGAAGTGAGAAGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984289852 4:177781647-177781669 TAGGGGAGCCAGAAGTGAGATGG + Intronic
984490045 4:180422435-180422457 ATTGGGAACCAGAACTGTGAGGG + Intergenic
984790098 4:183607426-183607448 GTGGGGAGCCGAAAGGGAGATGG + Intergenic
984967067 4:185148921-185148943 CTGGGGAGGCAGGAGTGAGTCGG - Exonic
985316189 4:188660958-188660980 ATGGGGAGACAGATGCCAGAGGG + Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987504836 5:18754368-18754390 ATGGGGAGCTGGAAGTGGGATGG + Intergenic
987764022 5:22201952-22201974 GTGGGAAGTCAGAAGTGGGAAGG + Intronic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988267230 5:28967709-28967731 TTGGGGAGCCAGAGGGGAGATGG - Intergenic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
988929914 5:36027805-36027827 ATGGGGAGTCAGGAATGTGAGGG - Intergenic
989204502 5:38797734-38797756 TGGGGGAGCCAGAAGGGAGCTGG + Intergenic
989642182 5:43593548-43593570 ATGGGGAGGGAAAAATGAGAGGG + Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
990585541 5:57207714-57207736 ATGGGAAGCCAGGAGGGAGATGG + Intronic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
992637122 5:78735748-78735770 ATGGGGAGCTAAAAGGGGGATGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
994310023 5:98259028-98259050 AAGGGGAGAGAGGAGTGAGAAGG - Intergenic
994871199 5:105351870-105351892 TGGGGGAGCCAGAAGACAGATGG + Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
996163073 5:120191242-120191264 TTGGGAAGCCAAAAGAGAGAAGG + Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996849541 5:127936937-127936959 ATGGGGGGAGAGGAGTGAGATGG + Intergenic
997600657 5:135136175-135136197 AAGGGGAGCCAGAAGGGACTTGG + Intronic
999069970 5:148734044-148734066 ATGTGGAGCATGGAGTGAGATGG - Intergenic
999279387 5:150354994-150355016 ATGTGGAGAGAGAAGAGAGATGG - Intergenic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999755304 5:154659756-154659778 CTGGGGTGCCATAAGTGGGAAGG - Intergenic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000516443 5:162241228-162241250 ATGGGGAGCCAGAAGCCGGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001616963 5:173050244-173050266 ATGGGGACCGAGTAATGAGAAGG + Intergenic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001877527 5:175214349-175214371 CTGGTGAGTCAGAATTGAGAAGG + Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002843354 6:924546-924568 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1002962230 6:1926084-1926106 TGGGGGAACCAGAAGAGAGATGG - Intronic
1003036485 6:2644782-2644804 AAGGGGAGCCGGAAGTCAGTGGG - Intergenic
1003131221 6:3396794-3396816 TGCGGGAGCCAGAAGGGAGATGG - Intronic
1003337283 6:5185922-5185944 AAGGGGAGGCAGGAGTGAGGAGG + Intronic
1003423159 6:5976110-5976132 ATGGGGAGCCAGCTAGGAGACGG - Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1003543813 6:7041464-7041486 TTGGGGAGTCTGAAGAGAGAAGG + Intergenic
1003911151 6:10744983-10745005 ATGTGGAGTGAGAAATGAGAGGG - Intergenic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1004554779 6:16685068-16685090 TTCTGGAGCCAGAAGTGGGAGGG - Intronic
1004749858 6:18551114-18551136 ATGTTGACCCAGAAGTCAGAAGG - Intergenic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005029293 6:21494043-21494065 ATGGGGAGCCAGAAGGGGTGTGG - Intergenic
1005712207 6:28513111-28513133 TGGGGGAGCCAAAAGAGAGATGG - Intronic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1007462467 6:42028432-42028454 ATGGGCAGACAAAAATGAGATGG - Intronic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1009349907 6:62661376-62661398 ATGGAGAGCTGGAAGTGGGATGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010063611 6:71654228-71654250 ATGGGCAGCCTGGAGTCAGAGGG - Intergenic
1010503986 6:76633749-76633771 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1010621790 6:78085709-78085731 ATGGGGAGCTGGAAATGAGATGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011330135 6:86195430-86195452 ATATATAGCCAGAAGTGAGATGG - Intergenic
1011616613 6:89203281-89203303 AAGGGGAGCCTGAAAGGAGACGG - Intronic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1013246854 6:108295020-108295042 ATTGGAACCCAGAAGAGAGACGG - Exonic
1013476109 6:110508791-110508813 ATGGGGAGCTAGAAGGGAGATGG - Intergenic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015690229 6:135914089-135914111 ATGAGGAGGAAGAAGTGACAAGG - Intronic
1015729616 6:136334745-136334767 TTGGGAAGCCAGAAGGGAGATGG - Intergenic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016457311 6:144244805-144244827 AAGGGGAGGCAATAGTGAGAAGG - Intergenic
1016464095 6:144308746-144308768 ATAGGGATGCAGAAGAGAGAAGG - Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018040883 6:159921178-159921200 ATGTGAAGACAGAAGTGATATGG + Intergenic
1018794418 6:167174860-167174882 CAGGGGAGCCAGAACCGAGATGG + Intronic
1018821901 6:167380207-167380229 CAGGGGAGCCAGAACCGAGATGG - Intronic
1018831086 6:167444115-167444137 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1018843043 6:167532196-167532218 TGGGGGAGCTAGAAGGGAGATGG - Intergenic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019321724 7:419066-419088 AGGGGCAGCCAGGAGTGAGCGGG + Intergenic
1019641838 7:2107426-2107448 ATGGGGAGCAGGAAGTGTGTCGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020520572 7:9180793-9180815 CTGTGGAGGCTGAAGTGAGAGGG + Intergenic
1021083054 7:16386147-16386169 ATGGGGAGCTAAAAGAGGGATGG + Intronic
1021273347 7:18619651-18619673 AGAAGGAGCCAGAAGAGAGAGGG + Intronic
1022508513 7:30921388-30921410 GTGGGGAGGAAGAAGAGAGAAGG + Intronic
1022517811 7:30987045-30987067 GGGGGGAGCCAGAAGGGAGCGGG + Intronic
1022753849 7:33262656-33262678 ATGGGGCGCATGAAGTAAGAGGG - Intronic
1022774642 7:33513290-33513312 ATGGGAAGCCAGAATAAAGAGGG - Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023114911 7:36853286-36853308 CTGGAGTGCCAGAAGAGAGAGGG + Intergenic
1023253539 7:38290687-38290709 TGGGGGAGCCAGACGGGAGATGG - Intergenic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024609849 7:51054999-51055021 ATGGGGAGCCAGGAGACAGGGGG + Intronic
1024623814 7:51187560-51187582 ATGGGCAGGCAGAGGTGAAAAGG + Intronic
1025273537 7:57550943-57550965 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026228015 7:68459682-68459704 GTGTGAAGCCAGAAGTGAGATGG + Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026996132 7:74617851-74617873 TGGGGGAGCCAGCAGAGAGAAGG + Intergenic
1029033216 7:97490597-97490619 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1030900024 7:115111873-115111895 ATGGGGACCCACAATTGGGAAGG + Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031642377 7:124180760-124180782 TCAGGGAGCCAGAAGAGAGACGG + Intergenic
1031765640 7:125773358-125773380 ATAGGGAGCCAGCAGGGGGATGG - Intergenic
1032119937 7:129148412-129148434 CTGGGGATCCAGAAGTGAATAGG - Intronic
1032259058 7:130319967-130319989 ATGGGGAACAAGAAGTTAGAGGG + Intronic
1032315511 7:130834925-130834947 ATAGGGAACAAAAAGTGAGATGG - Intergenic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1032943685 7:136825226-136825248 ATGCGGCGGCAGAAGGGAGATGG + Intergenic
1033418502 7:141185376-141185398 TGAGGGAGCCAGAAGGGAGATGG + Intronic
1033781189 7:144671276-144671298 GTGGGGAGGCAGAAGTAAGGAGG + Intronic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034119201 7:148611529-148611551 ATGGGGAGCCGGAAGTTGAAGGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035907804 8:3532395-3532417 ATGGTGAGCTAGAAGAAAGATGG + Intronic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036181331 8:6588029-6588051 TTGGGGAGGTAGAAGTGAAAGGG + Intronic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037226783 8:16602235-16602257 ATCGGGAGCCAGGAGGGGGATGG - Intergenic
1037959191 8:23083833-23083855 AGGGGCAGGCAGAAGAGAGAGGG - Intergenic
1038248595 8:25881927-25881949 TAAGGGAGCCAGAAGGGAGATGG - Intronic
1038301173 8:26350506-26350528 CTGGGGAGGCTGAAGTGGGAAGG - Intronic
1038496288 8:28005710-28005732 ATTGGGAGGCTGAAGTGAAAGGG + Intergenic
1038577347 8:28716623-28716645 CCGGGAAGCCAGAGGTGAGAGGG - Exonic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039669975 8:39584770-39584792 ATGGGATCCCAGAAGGGAGAGGG - Intronic
1040005390 8:42616635-42616657 ATGGAGAGCCAGATGGGAGTGGG - Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040959053 8:53011565-53011587 AGGGGGAACCAGAACTGAGCTGG + Intergenic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041647920 8:60272594-60272616 ATGGGGAGCCTGAGGTGTGTGGG - Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042150944 8:65783311-65783333 TTGGGGAGCCCCAAGTGTGATGG - Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043263160 8:78227338-78227360 CTTGGGAGGCTGAAGTGAGAGGG - Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044014380 8:87032602-87032624 AAGGGGAGGCAGAAGAGACAGGG + Intronic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1044473950 8:92604643-92604665 CTTGGGAGGCTGAAGTGAGAGGG + Intergenic
1044780682 8:95740588-95740610 AGGGGAGGACAGAAGTGAGAGGG + Intergenic
1045782390 8:105882356-105882378 ACCAGGAGCCAGAAATGAGAAGG - Intergenic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046049550 8:109006220-109006242 ATTGTGGGACAGAAGTGAGAAGG - Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046211290 8:111080614-111080636 ATGGGGAGGGAAGAGTGAGAAGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046796132 8:118374487-118374509 ATATGTACCCAGAAGTGAGATGG + Intronic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047255258 8:123209110-123209132 CTGGGGAGCCAGAGGGGAGCAGG + Exonic
1047542607 8:125785030-125785052 TGGGGGAGCAAGAAGGGAGATGG - Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047883156 8:129218586-129218608 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048833141 8:138495971-138495993 GTGGGGAGCTAGAAATGAGGTGG + Intronic
1048846481 8:138607470-138607492 ATGGGCAGGCAGTAGAGAGAGGG - Intronic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1049892980 9:88119-88141 ATGTGCTGCCAGAAGTGAGTGGG + Intergenic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050045293 9:1537410-1537432 ATTAGGAGCCAGATGTGAGATGG - Intergenic
1050269212 9:3924330-3924352 ATGGGGCCCCAGAAGTGAAAGGG - Intronic
1050342485 9:4654643-4654665 TGGGGGAGCCAGCAGGGAGATGG + Intronic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1050900839 9:10947133-10947155 GCGGGGAGCCAGAAGGGAAATGG + Intergenic
1051103580 9:13550957-13550979 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051521291 9:17991928-17991950 ATGGGGAGCAATGAGAGAGAGGG - Intergenic
1051724881 9:20078635-20078657 AGGAGTAGCCAGAAGGGAGATGG - Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1053221269 9:36315312-36315334 GTGGGGGGTCAGAAGTGTGAGGG + Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053734201 9:41088182-41088204 ATGTGCTGCCAGAAGTGAGTGGG + Intergenic
1054694194 9:68343370-68343392 AAGGGCTGCCAGAAGTGAGTGGG - Intronic
1055085510 9:72309658-72309680 CTTGGGAGCCACAGGTGAGAGGG - Intergenic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1055963366 9:81841834-81841856 TTGGGTAGCTAGTAGTGAGAGGG + Intergenic
1056243695 9:84672490-84672512 ATGGGGTGTCAGTAGTTAGATGG + Intronic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057937956 9:99256650-99256672 AGGAGGAGTCAGCAGTGAGATGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058403745 9:104646919-104646941 CTTGGGAGGCTGAAGTGAGAGGG + Intergenic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1059042495 9:110829909-110829931 TGGCGGAGCCAGAAGGGAGACGG - Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059930469 9:119255403-119255425 TGGGGGAGCCAGAGGTGGGAGGG + Intronic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060506960 9:124205068-124205090 CTTGGGAGGCTGAAGTGAGAGGG - Intergenic
1060791693 9:126489656-126489678 ATGGGGAGCCAGCAGGGTGACGG - Intronic
1060896683 9:127223421-127223443 ATAGGGAGACAGAAATGAGAAGG + Intergenic
1061300140 9:129699509-129699531 AGGAGGGTCCAGAAGTGAGAAGG + Intronic
1061500355 9:130998198-130998220 ATGGGGAGCCCAAAGGGGGAAGG - Intergenic
1062527072 9:136982282-136982304 ACAGGGAGCCAGAAGGGATATGG - Intronic
1185539907 X:894853-894875 GTGGGAAGGAAGAAGTGAGAAGG + Intergenic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185942865 X:4340803-4340825 TGGGGGAGCCAGCAGGGAGATGG + Intergenic
1185950106 X:4423043-4423065 AAGGGGAGCTGGAAGTGGGATGG + Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187424420 X:19164217-19164239 CTGGGGAGAGTGAAGTGAGAGGG - Intergenic
1188305573 X:28557249-28557271 ATGTGGTGGCAGAAGAGAGAGGG + Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1188807101 X:34605066-34605088 ATGGGGAGCTGGAAGTGGGATGG - Intergenic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189615221 X:42776323-42776345 ATGGGGTTGCAGAAGTGATAAGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190600822 X:52089973-52089995 ATGGGGAGCCAAAAGGGGAATGG - Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190842113 X:54154896-54154918 ATGTGGAGACAGAAAAGAGAAGG + Intronic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1193183624 X:78486896-78486918 TAGGGGAGCCAGAAGAGAGATGG + Intergenic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1193898240 X:87141118-87141140 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
1194377762 X:93156246-93156268 AGTGGAAGCCAGAAGTGAGCAGG + Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196261398 X:113586386-113586408 TGGTGGAGCCAGAAGGGAGATGG + Intergenic
1196697353 X:118627118-118627140 ATCTGGAGGCTGAAGTGAGAGGG + Intronic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1197889951 X:131259630-131259652 CTGGGGAACAAGGAGTGAGAGGG - Intergenic
1198167557 X:134072388-134072410 TGGGGGAGCCAGAAGATAGATGG + Intergenic
1198271000 X:135055925-135055947 TTGGGGAGCCAGATAGGAGATGG - Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199078384 X:143549565-143549587 ATGAGGAGCCAGGAGGTAGAGGG + Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199143309 X:144335917-144335939 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199882503 X:151985820-151985842 ATGAAGAGCCAGAAGAGAGCTGG + Intergenic
1200121932 X:153795173-153795195 ATGGGGAGCCAAAGGTGCGCAGG + Intronic
1200690383 Y:6303074-6303096 ATGGGGACCCACAAGGGAGATGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201044890 Y:9871642-9871664 ATGGGGACCCACAAGGGAGATGG - Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201340344 Y:12926352-12926374 GTGGGGAGCCAGAAGGGCGATGG + Intergenic
1201727786 Y:17172570-17172592 TTTGGGAGCCAGAAGGGAGATGG + Intergenic
1202107191 Y:21384020-21384042 ATGGTGAGCCAGAAGGGAGATGG + Intronic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic