ID: 1127822680

View in Genome Browser
Species Human (GRCh38)
Location 15:62673812-62673834
Sequence ATGTCTCTCTCTTAGTCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127822678_1127822680 -9 Left 1127822678 15:62673798-62673820 CCTTTCCTTTTTAAATGTCTCTC 0: 1
1: 0
2: 6
3: 71
4: 638
Right 1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG 0: 1
1: 0
2: 0
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127822680 Original CRISPR ATGTCTCTCTCTTAGTCTGA AGG Exonic
901591130 1:10344083-10344105 ATCTTTCTCTCATGGTCTGAAGG - Intronic
905031655 1:34887994-34888016 ATGATTGTCTCTTAGTCTCAGGG - Intronic
905241882 1:36586875-36586897 CTGACTCTCTCTGAGGCTGAAGG + Intergenic
906607114 1:47180332-47180354 ATGTGTCACTCTGAGTATGACGG + Intergenic
908580072 1:65505691-65505713 ATTACTCCCTCTTAGTTTGAAGG - Intronic
908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG + Intergenic
910114649 1:83718538-83718560 CTTTCTCACTCTGAGTCTGAGGG + Intergenic
910511430 1:88010539-88010561 AAGTCACTCTCTTAGTGTGAAGG - Intergenic
911972520 1:104455281-104455303 ATGTAGCTCTGTTAGACTGAAGG + Intergenic
916012088 1:160715280-160715302 ATGTCTCTCTGATAATTTGAAGG - Intergenic
917529197 1:175818763-175818785 TTCTCTCTCTCTCAGTCTGCTGG - Intergenic
917650480 1:177071799-177071821 ATGTCTCAGCCTTACTCTGAAGG - Intronic
918670954 1:187216163-187216185 AAGTCCCTGTCTGAGTCTGAAGG - Intergenic
919463591 1:197907003-197907025 ATATTTTTCTCTTAGTCTGCAGG + Intronic
920703588 1:208235799-208235821 ATCTTTCTCTCTAAGTCTGTGGG + Intronic
921479664 1:215649269-215649291 AAGTCTATCTCTTCCTCTGAGGG + Intronic
923026076 1:230205193-230205215 ATTTTTCTCTCTTACTCTCAAGG + Intronic
923928375 1:238662351-238662373 ATGTATTTCACTTAGTCTGTTGG + Intergenic
924160461 1:241226429-241226451 ATATCTCTATCTCAGTCTAAAGG + Intronic
1063982740 10:11469017-11469039 ATGTCTCTCTCTAAGGAAGAGGG + Intronic
1067768230 10:49105149-49105171 CTGTCTCTCTCTTTGTCTTTTGG - Intronic
1068267160 10:54666490-54666512 ATGTCTCTCTCAGAGTTTAAGGG - Intronic
1068547874 10:58371920-58371942 ATGCTTCTCTTTTATTCTGATGG + Intergenic
1069055716 10:63842707-63842729 CTGTCTCTCTCATAGTCTAGTGG + Intergenic
1071349173 10:84722193-84722215 ACATCTCTCTCTTAGTTTGAAGG + Intergenic
1071807842 10:89143583-89143605 CTGTCTCTGTATTATTCTGATGG - Intergenic
1072453785 10:95559679-95559701 ATGTCTCTTTCTTGGCCTGAGGG - Intronic
1072783939 10:98268046-98268068 CTGTCTCTCTGTGAGTCTGCAGG - Intronic
1072925888 10:99616627-99616649 ATGTCCCACTATTAATCTGAAGG + Intronic
1073282314 10:102363512-102363534 TTCCCTCTCTCTGAGTCTGAAGG - Intronic
1076883381 10:133250263-133250285 GTGTCTCTCTCTGTGTCTGTTGG - Intergenic
1082116805 11:48337744-48337766 TTGACTATTTCTTAGTCTGAAGG + Intergenic
1087403871 11:97703993-97704015 AAGTCTCTCTCTTTCTCTGGAGG + Intergenic
1088753066 11:112861862-112861884 ATGTCTTTCTTTAATTCTGAGGG + Intergenic
1089126192 11:116178155-116178177 ATGTTTCGCTTTGAGTCTGAAGG - Intergenic
1089606444 11:119644196-119644218 ATTTCACTATCTCAGTCTGAGGG - Intronic
1091623826 12:2107559-2107581 ATTTCTCTCGCTTAGGCTGGAGG + Intronic
1093157825 12:15709189-15709211 AAGTCTATCTCTTACTATGATGG - Intronic
1093405337 12:18797819-18797841 ATGTCTGTCACTTTGTCTCAAGG - Intergenic
1095513030 12:42974522-42974544 CTGTCTTTCTATTAGTCTGACGG + Intergenic
1096403673 12:51327274-51327296 TTGTCACTTTCTTAGTCTGCTGG + Intergenic
1099715816 12:86292054-86292076 ATGTCTCTGTCTTTATCTTAAGG - Intronic
1099806280 12:87524123-87524145 TTATCTCTTTCTTAGACTGATGG - Intergenic
1099944099 12:89224515-89224537 AAGTCTCTGTCCAAGTCTGAAGG - Intergenic
1100610118 12:96184884-96184906 AGGTCGCTGTCTTAGTCTGTTGG - Intergenic
1101268199 12:103114362-103114384 TGGTCTGTCTCTTAATCTGATGG + Intergenic
1102178392 12:110893191-110893213 TTGTCTGTCTCTGTGTCTGACGG + Intronic
1102187717 12:110962814-110962836 AGGACTCTCCCTTAGGCTGATGG + Intergenic
1102816056 12:115867505-115867527 ATGCATCTATCTCAGTCTGACGG - Intergenic
1103448381 12:121009962-121009984 ATGTTCCTCTCTTACTCTCATGG + Intronic
1106014129 13:25852060-25852082 ATGTCTCCTCCTCAGTCTGACGG + Intronic
1106971252 13:35144634-35144656 ATGTCCATCTCTTATTCTTATGG + Intronic
1107994192 13:45844512-45844534 ATGTCTCGCTCCAAGTCCGAAGG - Intronic
1108381139 13:49855548-49855570 ATGTCTCTCTCGGCTTCTGATGG - Intergenic
1110761004 13:79230163-79230185 CTCTCACTCTCTTACTCTGATGG + Intergenic
1115430804 14:33316431-33316453 CTGTGTCTCTCTGAGTCTGCAGG - Intronic
1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG + Intronic
1117797380 14:59408474-59408496 ATGTCTATCCCTTGGTCTGGGGG - Intergenic
1118209148 14:63750542-63750564 ATGTCTGTCTCTTGATTTGATGG - Intergenic
1119922370 14:78458168-78458190 GTGTCTCTCTCTAGGTCAGAAGG - Intronic
1119964630 14:78900535-78900557 TTTTCTCTCTCTTCTTCTGAAGG + Intronic
1120511952 14:85425997-85426019 ATGTCTATAATTTAGTCTGATGG - Intergenic
1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG + Exonic
1130702044 15:86193906-86193928 ATGCCTCTCTCTTGGCCTGATGG - Intronic
1130823724 15:87521974-87521996 ATGTCTTTCTCTTTCTCTGGAGG - Intergenic
1131500779 15:92963626-92963648 ATTGCTTTCTTTTAGTCTGAAGG + Intronic
1131732115 15:95293110-95293132 AAGCCTCTCTCTTTGTCCGAGGG - Intergenic
1131825145 15:96315084-96315106 CTTTCTCTCTCTTAGTTGGAAGG - Intergenic
1132121382 15:99179014-99179036 CTGTGTATCTCTCAGTCTGAGGG + Intronic
1133521356 16:6560766-6560788 CTGTCTCTCTCATAGACTGTAGG + Intronic
1137382324 16:48010962-48010984 ATGTATGTGTCTTAGTCTGTTGG + Intergenic
1137492856 16:48947675-48947697 ATCTCTCTCTCATAGCCAGAGGG + Intergenic
1140408439 16:74726343-74726365 ATGTATCTCTCTCACCCTGATGG - Intronic
1141416311 16:83878077-83878099 ATGTCTCTATTTTAGACAGAGGG - Intergenic
1142514857 17:421021-421043 TTGTCTCGCCCTTAATCTGAGGG + Intronic
1146831476 17:36073081-36073103 AAGTCCCTGTCTGAGTCTGAAGG - Intergenic
1148805727 17:50263089-50263111 ATGCCTCTCCCTGAGTCTCAGGG - Intergenic
1149956848 17:61060591-61060613 ATGACTCTCTGTCAGTCTGCAGG + Intronic
1150560437 17:66289710-66289732 TTCTCTCTCTCTTGGTCTGTTGG - Intergenic
1151618355 17:75229556-75229578 CTGTCTCTCTCTCACTCTGAAGG - Intronic
1155250109 18:23946122-23946144 ACGTATCTTTCTTACTCTGAAGG + Exonic
1155302012 18:24438917-24438939 ATTTCTCTCTCTTTGTGTGTGGG - Intronic
1155929178 18:31687402-31687424 GTCTGTCTCTCATAGTCTGAGGG + Intergenic
1157213859 18:45765695-45765717 CTCTCTCTCTCTTATTCTGTTGG - Intergenic
1157675068 18:49562557-49562579 CTGTCTCTCTGCTGGTCTGATGG + Intronic
1157745043 18:50127935-50127957 ATGTCTCAGTTTGAGTCTGAAGG - Intronic
1158063725 18:53379501-53379523 ATGTCTTTCTCTGGGGCTGAGGG - Intronic
1158741236 18:60144547-60144569 GTGTCTCTCTCTTAAGCTGTTGG + Intergenic
1159461515 18:68726989-68727011 AGTTCTCTCATTTAGTCTGAGGG - Intronic
1159704299 18:71667395-71667417 ATGTCAGTCTCATAATCTGAAGG - Intergenic
1162010656 19:7812114-7812136 ACCTTTCTCTCTTAGTCTGTTGG - Intergenic
1162519994 19:11174084-11174106 ATGTGGCCCTCCTAGTCTGATGG - Intronic
1164432068 19:28197355-28197377 TTGTCTCTGTCTTTGCCTGAGGG - Intergenic
1166644337 19:44520007-44520029 ATCTCAGTCTCTCAGTCTGATGG + Intronic
1167429903 19:49448157-49448179 ATGTCTCTCTCTGCTTCTTACGG - Intronic
926104394 2:10141345-10141367 ATGTCTCACTCTGAGCCTTAGGG + Intergenic
926890759 2:17637237-17637259 ATTTATCTCTCTGAGTCTGCAGG - Intronic
927102539 2:19799174-19799196 ATCTCTCTCTCTTCCTCTGAAGG + Intergenic
927293246 2:21424745-21424767 TTCTCTCTCTCTTTGTCTGAAGG - Intergenic
932097952 2:68868507-68868529 ATGTCTCTATCCTACTATGATGG + Intronic
932285866 2:70531131-70531153 CTGTCTGGCTCTTAGTCAGAAGG - Intronic
933195247 2:79382203-79382225 AAGTCTCAGTCTGAGTCTGAAGG - Intronic
936252274 2:110876097-110876119 ATGTCCCTCTCAAAGTCAGAAGG + Intronic
938719424 2:134052848-134052870 AGGTCTCTCTCTTTGCCTCATGG + Intergenic
940592764 2:155750021-155750043 GTGTTTCACTCTTAGTTTGATGG - Intergenic
942430561 2:175906820-175906842 ATGTGTTTCTCTTTGTCTGTTGG + Intergenic
943741046 2:191409474-191409496 TTGTTTCTCTCTTTGTCTAAAGG + Intronic
945644955 2:212479547-212479569 CTCTCTCTCTCTTAGTATGAAGG + Intronic
946804560 2:223458276-223458298 ATATGTCTGTCTTAGTTTGATGG + Intergenic
947270143 2:228325655-228325677 ATGTCTTTCTCCTACTCTTAGGG + Intergenic
947880421 2:233505137-233505159 ATGTTTCTATTTTAGTCTCAAGG - Intronic
1169111757 20:3038674-3038696 ATGTCTCTCCCTTTGTCTGGGGG + Exonic
1169254184 20:4084821-4084843 ATCACTCTCTCTGGGTCTGATGG + Intergenic
1170063333 20:12283847-12283869 ATGTTTCTTTCTTATTATGATGG - Intergenic
1171250548 20:23642858-23642880 CTGTCTCTCTCTTATTGCGACGG + Intergenic
1173025464 20:39303725-39303747 ATTTCTCACTCTTAGTTTGATGG + Intergenic
1174140692 20:48411522-48411544 ATGACTCTCTCTGAGTGAGAGGG - Intergenic
1174145817 20:48451757-48451779 TTTTTTCTCTTTTAGTCTGAGGG - Intergenic
1175537997 20:59728897-59728919 ATGTCTCACTGTTGCTCTGATGG + Intronic
1176267710 20:64219311-64219333 GTGTCTCCCTCTGAGCCTGAGGG + Intronic
1176387617 21:6146679-6146701 ATGTCACCATCTGAGTCTGAAGG + Intergenic
1177554786 21:22675297-22675319 ATGTCTCTATCTCAGTCTAAGGG + Intergenic
1179014185 21:37581216-37581238 ATGGTTCTCTCTCAGTTTGATGG + Intergenic
1179292483 21:40030809-40030831 CTGTCACTTTCTGAGTCTGAGGG - Intronic
1179735855 21:43391569-43391591 ATGTCACCATCTGAGTCTGAAGG - Intergenic
1181504851 22:23346325-23346347 ATGAATCACTCTTAGTGTGATGG - Intergenic
1181709840 22:24676570-24676592 ATGAATCACTCTTAGTGTGATGG - Intergenic
1182964306 22:34506907-34506929 TTAACTCTTTCTTAGTCTGAGGG - Intergenic
1182995332 22:34807073-34807095 ATTTCTATCTCTTAGTGGGAGGG - Intergenic
1183569196 22:38639534-38639556 ATGTTTCTGTCTTCTTCTGAAGG - Intronic
1183654764 22:39177993-39178015 CTGTCTCTCTGTCTGTCTGAGGG + Intergenic
1184597880 22:45525413-45525435 ATTTCTCTCTCTGTGTCTGTGGG + Intronic
951283215 3:20778502-20778524 ATGTCTCTTTCTTATTCTAGTGG - Intergenic
954433437 3:50483526-50483548 ATGGCTCACTGTTAGTCTGAGGG - Intronic
954815026 3:53273521-53273543 ATGTCAGTCCTTTAGTCTGAAGG - Intergenic
955728524 3:61959018-61959040 CTTTCTGTCTCTTGGTCTGATGG + Intronic
955868217 3:63408486-63408508 ATGTCTCAATCTAAGTCTGAAGG + Intronic
957445965 3:80313268-80313290 AAGTACCTCTGTTAGTCTGATGG - Intergenic
958703003 3:97617061-97617083 AAGGTTCTCTGTTAGTCTGATGG - Intronic
958845473 3:99260094-99260116 GTGTTTCTCTCTGAGTGTGAGGG + Intergenic
960589983 3:119356179-119356201 AAGTCTCTCTCTTACTCAAAGGG + Intronic
963032721 3:140994941-140994963 ATGTTTCCATCTGAGTCTGAAGG + Intergenic
963177068 3:142310048-142310070 ATATTTCTCTCTTATACTGAAGG + Exonic
963363001 3:144301210-144301232 ATATCTTTCTCTTTGTTTGAAGG + Intergenic
963524241 3:146396386-146396408 ATGAGTATCTCTTATTCTGAAGG - Intronic
963621539 3:147613615-147613637 ATGTGTTTATCTTGGTCTGAAGG - Intergenic
963713613 3:148776894-148776916 ATGTCTCAGTCCAAGTCTGAAGG - Intergenic
964529609 3:157652935-157652957 ATGTCTCTCTATGAGTGTGTGGG - Intronic
964618630 3:158698182-158698204 ATGTCTGTCACTTTTTCTGATGG + Intronic
964925907 3:161956698-161956720 ATATATATCTCTTAGGCTGATGG - Intergenic
965545769 3:169915019-169915041 ATCTCCCTTTCTCAGTCTGAAGG + Intronic
965752594 3:171991778-171991800 ATGTCTCTCTCTCTCTCTGTCGG + Intergenic
966559999 3:181309448-181309470 ATGTCTCCCCCATAGCCTGAAGG - Intergenic
967568033 3:190993954-190993976 TTAACTGTCTCTTAGTCTGAGGG + Intergenic
968122526 3:196135719-196135741 GTGTCCCTCCCTTTGTCTGATGG + Intergenic
968697014 4:2035851-2035873 AGGCCTGTTTCTTAGTCTGAGGG + Intronic
969992943 4:11283125-11283147 ATGTCTCTCTCATAATATGTGGG + Intergenic
971005003 4:22363522-22363544 ATGTCTCTCTACTAGTATAATGG + Intronic
971558924 4:28049563-28049585 ATTTTTCTCTCTTTTTCTGAAGG + Intergenic
971636446 4:29065516-29065538 ATGTCTCTCTTTTTCTGTGAAGG - Intergenic
972194803 4:36640824-36640846 CTGTCTTTCTCTCAGTCAGATGG - Intergenic
975724534 4:77279093-77279115 AGGTCTCTCTACTAGGCTGAGGG + Intronic
977607762 4:98999111-98999133 ATGTCTGTTTTTTAGTCGGAAGG + Intronic
978130668 4:105192723-105192745 GTGTCTGTCTCTTACTCTAATGG - Intronic
978968199 4:114768770-114768792 ATACCTCTGTATTAGTCTGAGGG - Intergenic
979938081 4:126722642-126722664 ATGTTTCAGTCTAAGTCTGAAGG + Intergenic
981632958 4:146842430-146842452 ATGACTCTCTATAAGTCTGTGGG - Intronic
983897549 4:173098127-173098149 GTGTCTCTCTCTCTGTCTCATGG + Intergenic
984784056 4:183552272-183552294 TTCTCCTTCTCTTAGTCTGAAGG + Intergenic
985866412 5:2517741-2517763 ATGTCTCCCACTTAGTCTCCAGG - Intergenic
986069855 5:4271025-4271047 GTGTCTCTCCTTTACTCTGATGG - Intergenic
987603695 5:20105885-20105907 AAGTATCTCTTTGAGTCTGAGGG + Intronic
988836867 5:35041679-35041701 ATGTCTCTTTCTCAGCATGAAGG + Intronic
989506484 5:42231555-42231577 ATCTCTCTGTGTCAGTCTGAAGG + Intergenic
992000678 5:72433007-72433029 ATGTATCAATCTTGGTCTGATGG + Intergenic
992387086 5:76295010-76295032 AACTCTCTCTCCTAGTCTGGTGG - Intronic
993215402 5:85016444-85016466 AAGTCTCTCTATTAGTTTGCTGG + Intergenic
993251303 5:85527422-85527444 ATGTCTCAGTTTGAGTCTGAAGG + Intergenic
993766209 5:91861983-91862005 AAGTCTCTCTTTAAGACTGATGG - Intergenic
995763673 5:115591717-115591739 GTTTCTCTCCCTTATTCTGAAGG - Intronic
998517782 5:142771086-142771108 GGGTCTCTCTCTTCATCTGATGG - Intronic
1001142458 5:169156221-169156243 ATTTCTCACTCTTTGTCAGAAGG - Intronic
1001272284 5:170322740-170322762 ATGGCTCACTCCAAGTCTGAAGG - Intergenic
1003266416 6:4568421-4568443 ATTTTTCTTTCTCAGTCTGAGGG - Intergenic
1005215274 6:23520007-23520029 ATCTCTCTCTTCTAGTCTGAGGG + Intergenic
1005416955 6:25610115-25610137 CCATCTCTCTCTTTGTCTGAAGG - Exonic
1007923396 6:45630738-45630760 ATGTATCTCTCTCAGGCTTAGGG + Intronic
1008468634 6:51858305-51858327 ATGGCTCTCTCTTCCCCTGATGG + Intronic
1010364684 6:75035825-75035847 CTCTCTCTCTCTTTGTCTCATGG - Intergenic
1010634705 6:78243472-78243494 ATCTCTCTATGTGAGTCTGAAGG - Intergenic
1015389444 6:132664588-132664610 ATGTCTCAGTTTGAGTCTGAAGG + Intergenic
1017436161 6:154417706-154417728 ATGTCTGTGTCTTAATCTTATGG - Intronic
1018297222 6:162361602-162361624 TTTTCTCTCTCTTGGTCTGTCGG - Intronic
1018588376 6:165388260-165388282 CCGTCTCTCGCTTAGTCTGAAGG - Intronic
1018621760 6:165735562-165735584 ATGTCCCTGTTTGAGTCTGAGGG + Intronic
1021355002 7:19643449-19643471 ATATCTCTCCCTTAGTCCAATGG + Intergenic
1024984729 7:55185197-55185219 ATGTCTCTCTCATGGTCTACTGG - Intronic
1026478147 7:70754752-70754774 ATGTCTCTTTCTAAGTCATAAGG + Intronic
1027234379 7:76289335-76289357 ATTTCTCTCTCTTAGAGTGGTGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1029471469 7:100757361-100757383 ATGTGTCTCTCTGAATCTGAGGG - Intronic
1030731534 7:112995654-112995676 AAGACTCTCTCTTTCTCTGAGGG + Intergenic
1030935121 7:115576180-115576202 ATGCATCTCTCTGAGTGTGAGGG + Intergenic
1031198151 7:118642917-118642939 ATCTCTCTGTCTTAGACGGATGG - Intergenic
1031927162 7:127649989-127650011 TTGTCTCTCACTTGCTCTGATGG + Intergenic
1032455986 7:132073907-132073929 ATGTCTCACTCTCATTCTGCGGG + Intergenic
1035886377 8:3295736-3295758 ATGTAGAACTCTTAGTCTGACGG - Intronic
1037701388 8:21277552-21277574 GTGTCATTTTCTTAGTCTGAAGG + Intergenic
1038883008 8:31635537-31635559 ATGTCTCTCTCTCTGTCGAATGG - Intergenic
1039124470 8:34185735-34185757 ATCTTTCCCTCTTAGACTGATGG + Intergenic
1039451812 8:37680859-37680881 ATGTATCTTTCTTTGTCTGATGG - Intergenic
1039834451 8:41245748-41245770 ATCTCTCGCTTTTACTCTGAAGG - Intergenic
1040034531 8:42857261-42857283 ATGATTTTCTCTTAGTCTGGGGG - Intronic
1041012994 8:53561917-53561939 AAGTTTCACTGTTAGTCTGATGG - Intergenic
1044052695 8:87527914-87527936 ATGTCTCCCTCTGAGGCAGAAGG - Intronic
1047885517 8:129246059-129246081 ATTTCTTTCTCTTTGACTGAAGG - Intergenic
1048130125 8:131687066-131687088 TTGTCTATGTCTTGGTCTGAGGG - Intergenic
1050767582 9:9154137-9154159 AGGTCTTTCTTTTGGTCTGACGG - Intronic
1052030315 9:23621167-23621189 TTGTCTCTCTCTTCCTTTGAGGG - Intergenic
1052839841 9:33283298-33283320 ATGTCTCTCACATAGTCTTTTGG + Intergenic
1055556794 9:77482417-77482439 AGAGATCTCTCTTAGTCTGATGG + Intronic
1058459301 9:105168090-105168112 AAGTATCTGTCTGAGTCTGAAGG + Intergenic
1059811504 9:117860524-117860546 ATGTTTATCTCTGAGTCAGAGGG - Intergenic
1059970897 9:119667104-119667126 AAGTCTCTGTCTTGGTCTAATGG + Intergenic
1186402793 X:9274945-9274967 CTGTCTCTCTCTCTCTCTGACGG - Intergenic
1186845340 X:13525249-13525271 GTGTCTCTCTCTGAGGCAGAAGG + Intergenic
1188989693 X:36802594-36802616 ATGGATCGCTCTAAGTCTGAGGG - Intergenic
1190496959 X:51035853-51035875 ATGTCACTCTCTCAGTCAAAGGG + Intergenic
1190509078 X:51158538-51158560 ATGTCTCTCTCTCGGTCAGAGGG - Intergenic
1190966238 X:55304051-55304073 ATGATTCACTGTTAGTCTGATGG + Intergenic
1191099437 X:56709867-56709889 AGGTCCCACTGTTAGTCTGATGG + Intergenic
1192449292 X:71233525-71233547 ATTTCTCTCTCTTAACCTTAGGG - Intergenic
1194455585 X:94099083-94099105 AAATCTCTCTATGAGTCTGATGG + Intergenic
1195283160 X:103356886-103356908 CTTTCTCACTCTTTGTCTGATGG + Intronic
1196170043 X:112577383-112577405 ATGTTTCACTTTGAGTCTGAAGG + Intergenic
1196298287 X:114024555-114024577 ATGTCTCTCCCTTGGTGTGTAGG - Intergenic
1196418340 X:115497037-115497059 ATGTATCTCTTTAAGTCTGAGGG - Intergenic
1196738382 X:119001189-119001211 CTGTCTCTCTCTTTTTCAGAAGG + Intronic
1198110224 X:133496413-133496435 CTCTCTCTCTCTCAGCCTGAAGG - Intergenic
1198220614 X:134597958-134597980 ATGTCACTCTTTGAGTCTCAAGG + Intronic
1201886062 Y:18882875-18882897 GTGTCTTTTTCTTGGTCTGAGGG + Intergenic