ID: 1127823304

View in Genome Browser
Species Human (GRCh38)
Location 15:62679941-62679963
Sequence ATGCAAAAGTAACTCGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127823304_1127823309 24 Left 1127823304 15:62679941-62679963 CCTCCATCGAGTTACTTTTGCAT 0: 1
1: 1
2: 6
3: 31
4: 172
Right 1127823309 15:62679988-62680010 ATCTATATGGGTCTATTTCTGGG 0: 2
1: 21
2: 134
3: 493
4: 1847
1127823304_1127823306 11 Left 1127823304 15:62679941-62679963 CCTCCATCGAGTTACTTTTGCAT 0: 1
1: 1
2: 6
3: 31
4: 172
Right 1127823306 15:62679975-62679997 TCTAGTTCAGCACATCTATATGG 0: 1
1: 0
2: 0
3: 4
4: 90
1127823304_1127823308 23 Left 1127823304 15:62679941-62679963 CCTCCATCGAGTTACTTTTGCAT 0: 1
1: 1
2: 6
3: 31
4: 172
Right 1127823308 15:62679987-62680009 CATCTATATGGGTCTATTTCTGG 0: 2
1: 4
2: 45
3: 261
4: 1006
1127823304_1127823307 12 Left 1127823304 15:62679941-62679963 CCTCCATCGAGTTACTTTTGCAT 0: 1
1: 1
2: 6
3: 31
4: 172
Right 1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127823304 Original CRISPR ATGCAAAAGTAACTCGATGG AGG (reversed) Intronic
902083516 1:13838379-13838401 ATGCAAAAGCATTTCAATGGAGG - Intergenic
905718974 1:40179462-40179484 ATGCAAAAGGAAGACGACGGGGG - Intronic
908250509 1:62261811-62261833 AGGCAGAAGGAACTCCATGGAGG - Intronic
909170772 1:72291731-72291753 ATGCAAAAGCAATTCAATGGAGG - Intergenic
910742018 1:90529877-90529899 ATTCTAAAGTAAATTGATGGTGG - Intergenic
911545813 1:99215068-99215090 ATGCAAAAGTGAATGGATGGGGG - Intergenic
913464318 1:119124040-119124062 ATGCAACAGTAACACGATTTTGG - Intronic
916014578 1:160738269-160738291 ATACAAAAGTAATTCAATGTAGG + Intergenic
921715445 1:218412864-218412886 ATACAAAAATAACTCCCTGGGGG + Intronic
922017597 1:221667073-221667095 GTACCAAAGTAATTCGATGGGGG - Intergenic
1064733679 10:18359056-18359078 ATGGAAAAGTAACATGTTGGGGG + Intronic
1065348800 10:24776295-24776317 ATGCAAAATTAACTCAAATGGGG - Intergenic
1067246004 10:44545034-44545056 GTGCAAAAGCAATTCAATGGTGG - Intergenic
1067764905 10:49077543-49077565 GTGCAAAAGTAATTCAACGGCGG + Intronic
1067852992 10:49767537-49767559 GTGCAAAAGCAATTCAATGGGGG - Intergenic
1068458924 10:57300314-57300336 ATGCAAAAGTAATTCAATGAAGG + Intergenic
1069320424 10:67164340-67164362 ATGCAGAAGTAATCCAATGGAGG + Intronic
1071246148 10:83766605-83766627 ATGCAAAAGCAATTCAATGGAGG - Intergenic
1071443077 10:85720546-85720568 ATACAAAAGCAATTCCATGGAGG + Intronic
1073041484 10:100610038-100610060 ATGCTAAAGTCACTGGATGAAGG + Intergenic
1075309487 10:121401020-121401042 AGTCAAAAGTAATTCAATGGAGG + Intergenic
1075958833 10:126548899-126548921 GTGCAAAAGCAATTCAATGGAGG + Intronic
1079887752 11:26009254-26009276 GTGCAAAAGCAACTCAGTGGAGG - Intergenic
1083420830 11:62552190-62552212 ATGCAAAAGAACCTTCATGGGGG - Intronic
1084754813 11:71230799-71230821 GTGCAAAAGCCACTCAATGGAGG + Intronic
1086382435 11:86270782-86270804 GTGCAAAAGCAATTCAATGGCGG - Intronic
1088564850 11:111159351-111159373 ATACAAAAATAACTCAATAGAGG - Intergenic
1089912917 11:122120922-122120944 ATGCCAAGGAAACTCAATGGGGG + Intergenic
1090913580 11:131142920-131142942 ATGCAAAATGAACTTGGTGGTGG - Intergenic
1091547860 12:1516049-1516071 GTGCAAAAGAAAATCAATGGAGG - Intergenic
1091809419 12:3382970-3382992 CTACAAAAGTAATTCAATGGAGG - Intronic
1096896835 12:54829612-54829634 ATGAAAAAGTCAATCAATGGAGG - Intergenic
1097912686 12:64987491-64987513 ATACAAATATAACTCAATGGAGG - Intergenic
1099821792 12:87720619-87720641 AAGCAATAGTAACTCCATGAGGG - Intergenic
1101921496 12:108936821-108936843 CAGCAAAAGTAACTAGACGGAGG - Intronic
1108197073 13:48005656-48005678 GTGCAAAAGTAATTCAACGGAGG + Intergenic
1108269285 13:48743315-48743337 ATCCAAAAGCAATTCAATGGAGG - Intergenic
1108834374 13:54522852-54522874 AGTCAAAAGTCAATCGATGGTGG - Intergenic
1112814521 13:103256316-103256338 CTGCAAAAGTACCTTGCTGGAGG - Intergenic
1113476794 13:110588922-110588944 ATTCAAAAGCAACTTAATGGAGG + Intergenic
1118100730 14:62599299-62599321 ATGCAAAAGGAGTTCTATGGGGG + Intergenic
1121997110 14:98611451-98611473 ATGCAAAAGTAACTGGAAGAAGG - Intergenic
1122311768 14:100801688-100801710 ATGCAAAAGTTAGCCGAGGGTGG - Intergenic
1122383562 14:101328338-101328360 ATGCAACAGCAATTCAATGGCGG - Intergenic
1122815785 14:104312653-104312675 GTGCAAAAGTAATTTAATGGAGG + Intergenic
1124505462 15:30268898-30268920 AAGCAAAAGCATCACGATGGTGG - Intergenic
1124623425 15:31293290-31293312 ATGAAAAATTGACTAGATGGAGG - Intergenic
1124738090 15:32269733-32269755 AAGCAAAAGCATCACGATGGTGG + Intergenic
1127823304 15:62679941-62679963 ATGCAAAAGTAACTCGATGGAGG - Intronic
1128486987 15:68102223-68102245 ATGCAAAAGTAATTCAATGGAGG - Intronic
1130392216 15:83467299-83467321 ATGCAAAAGCAATTCAACGGAGG - Intronic
1130626131 15:85517362-85517384 TGGGAAAAGTAACTTGATGGGGG - Intronic
1130756526 15:86770298-86770320 ATGCAAAATCAACCCCATGGAGG - Intronic
1132784340 16:1646908-1646930 ATGCAAAGGCCACTCAATGGAGG - Intronic
1133539986 16:6741097-6741119 ATGCAAAAGCAATTTAATGGGGG + Intronic
1135881019 16:26257239-26257261 GTGCAAAAGCAATTCAATGGAGG + Intergenic
1135921572 16:26653883-26653905 GTGCAAAAGTAATTCAGTGGAGG - Intergenic
1137865928 16:51895949-51895971 ATACAAAAATAACTCCGTGGGGG - Intergenic
1140160038 16:72480407-72480429 TTGCAAAAGCAATTCAATGGAGG + Intergenic
1143127226 17:4650718-4650740 ATGCAAAGGCAATTCAATGGAGG - Intergenic
1148072090 17:44914525-44914547 AAGTCAAAGTAACTTGATGGGGG + Intronic
1148192587 17:45689934-45689956 ATGAAAAAATAATTCAATGGAGG + Intergenic
1153464790 18:5377464-5377486 ATGCAAAATGAAGTTGATGGAGG + Intergenic
1153808306 18:8730064-8730086 ATGCAAAAGTAATTCGATGGAGG - Intronic
1154099775 18:11461283-11461305 GTGCGAAAGTAATTCAATGGTGG - Intergenic
1155418772 18:25630935-25630957 ATGCAAAAGCAACTTAATGGAGG + Intergenic
1155590036 18:27417298-27417320 GTGCAAAAGCAATTCAATGGGGG + Intergenic
1156756449 18:40533166-40533188 ATGCAAAAGTAATTTAGTGGAGG - Intergenic
1158371528 18:56811741-56811763 GTGCAAAACCAATTCGATGGGGG - Intronic
1159738690 18:72137056-72137078 ATGCCAAAGTAACATGATGATGG + Intergenic
1159829375 18:73255497-73255519 ATGCAAAGGCAATTCAATGGAGG + Intronic
1159927270 18:74280730-74280752 ATGGAAAAGCAAGTCGATAGAGG - Intronic
1164717159 19:30401131-30401153 ATGCAAAAGCAATTCCATGAAGG - Intronic
1166898979 19:46043668-46043690 ATGCAAAAGCAATTCAATGTGGG + Intronic
926421050 2:12699758-12699780 ATGAATAAGTAAATGGATGGAGG + Intergenic
930520494 2:52460058-52460080 GTGCAAAAGAAACTCGATGAAGG + Intergenic
932057924 2:68466200-68466222 ATACAAAAGTAACTCAAGGATGG - Exonic
933319155 2:80750544-80750566 GTGCAAAAGCAAATCAATGGAGG - Intergenic
934073010 2:88402861-88402883 GTGCAAAAGTGATTCAATGGAGG + Intergenic
934757842 2:96836987-96837009 GTGCAAAAGTAATTCAATGGAGG - Intronic
934879416 2:97961757-97961779 GTGCCAAAGCAACTCAATGGAGG + Intronic
934908818 2:98231482-98231504 GTGCAAAATTAACTCAATGGAGG + Intronic
935151864 2:100444452-100444474 ATGCAAAAGCAATTCTATGGAGG - Intergenic
935412084 2:102774718-102774740 ATGCAAAAGCAACTCAATGCAGG - Intronic
938212697 2:129481886-129481908 ATGCACAAGGCACTCCATGGTGG + Intergenic
938633238 2:133192173-133192195 ATGCAAAAGTAATTCCATGTGGG + Intronic
939724239 2:145695425-145695447 ATGCCAAGGTAGCTCAATGGAGG - Intergenic
940196358 2:151099111-151099133 GTGCAAAAGCAATTCAATGGAGG + Intergenic
940952819 2:159695643-159695665 ATGCCAAGGTAATTCAATGGGGG - Intergenic
941504980 2:166331391-166331413 ATGTGAAAGAAACTTGATGGAGG - Intronic
941868111 2:170355651-170355673 AATCAAAAGTAACTCAAAGGAGG - Intronic
942480080 2:176376634-176376656 ATGCCAAAGTAATTCAATGTGGG - Intergenic
942885643 2:180919934-180919956 GTGCAAAAGCAATTCAATGGAGG + Intergenic
943647656 2:190424700-190424722 ATGCAAAAAAAATTCAATGGTGG - Intronic
943719427 2:191188295-191188317 TTGCAAAAGTAATTTAATGGAGG - Intergenic
944207505 2:197172154-197172176 ATGCAAAAGTTAGTCGAGTGTGG - Intronic
945002936 2:205370948-205370970 ATTCACAAGTAACTCCAGGGGGG + Intronic
945155905 2:206837250-206837272 ATTCAAAAGTCACTTCATGGTGG - Intergenic
946743515 2:222823344-222823366 AGGCAAAAGTAACTCCATCTTGG - Intergenic
1169643565 20:7782325-7782347 GTGCAAAAGTAACTGAAAGGAGG - Intergenic
1170714772 20:18822141-18822163 AGGCAACAGTAACTAGAAGGGGG - Intronic
1171071760 20:22076083-22076105 GTGCATAAGTAATTCCATGGGGG - Intergenic
1173063746 20:39688629-39688651 ATGCACAAGAAATTCAATGGAGG + Intergenic
1177394272 21:20512398-20512420 AAGGAAAAGTAACTGGATGAAGG + Intergenic
1177778008 21:25591003-25591025 ATGCAAAAGTAACTCAGTGGAGG + Intronic
1177863688 21:26486540-26486562 GTGCAAAAGCAATGCGATGGGGG - Intronic
1178909592 21:36663863-36663885 ATGCAAAAATAACTCTTTGAGGG - Intergenic
1179299468 21:40093530-40093552 ATGGAAAAGTAATTCCCTGGAGG - Intronic
1181578693 22:23814305-23814327 ATGCAAATGTGATTCAATGGAGG + Intronic
950174395 3:10862445-10862467 ATCCAAAATTCACTCGATGAGGG - Intronic
950461777 3:13127056-13127078 ATGCAAAAGCAATTTAATGGAGG - Intergenic
952841478 3:37650327-37650349 ATGCAACAATATCTCGATGATGG - Intronic
952867921 3:37868668-37868690 ATGCAAAAGAAATTCAAAGGAGG - Intronic
953423881 3:42776799-42776821 GTGCAAAAGCAATTCAATGGAGG - Intronic
953560950 3:43993028-43993050 CTGCAAAAGCAATTCAATGGAGG + Intergenic
955602593 3:60662995-60663017 ATGCAAAAGCAACTTAATGAAGG - Intronic
960390948 3:117076953-117076975 ATGCAAAAATGACTAGATGTTGG + Intronic
961724493 3:128917509-128917531 GAGCAAAAGTAACTAGATGCTGG + Intronic
966084412 3:176051246-176051268 ATGCAAAAGAAACAAGAAGGAGG - Intergenic
968816233 4:2823322-2823344 ATGCAGAAGTCACTGGGTGGTGG - Intronic
969953723 4:10866578-10866600 ATCCAAAAGCAAATCTATGGGGG - Intergenic
972352393 4:38248157-38248179 ATGCAAAAGTAATTCAGTTGAGG - Intergenic
976959021 4:90943867-90943889 ATACAAAAGTAACAGGCTGGGGG - Intronic
977179138 4:93852680-93852702 ATGCAAAAGTTAATCGATTATGG + Intergenic
977691110 4:99912138-99912160 ATGCAAAAGCAGTTCGATGGAGG - Intronic
977827083 4:101545697-101545719 ATGCAAAAGCAATTCAATGGAGG - Intronic
978406804 4:108388739-108388761 GTGCAAAAGCAATTCAATGGAGG + Intergenic
979687770 4:123529524-123529546 ATGTAAAAGTAACTCACTGTGGG + Intergenic
979909300 4:126341269-126341291 CTGTAAAAGTAATTCAATGGAGG - Intergenic
980351375 4:131689281-131689303 ATCCAGAAGAAACTCAATGGTGG + Intergenic
980910071 4:138986318-138986340 ATACAAAAGCAACTCAATGGAGG - Intergenic
981355070 4:143780662-143780684 ATACAAAAATGACTAGATGGGGG - Intergenic
984862910 4:184255882-184255904 ATGCAAAAGTGTCTCGCTTGTGG - Intergenic
987080744 5:14423257-14423279 ATGCAGAAGAGACTCGCTGGGGG - Intronic
988633775 5:32959400-32959422 ATGCTAATGTAAATCTATGGTGG - Intergenic
989512620 5:42305845-42305867 ATGCAAAAGTAAATACATGTGGG + Intergenic
989664581 5:43838889-43838911 TTGCAAAAGTCACTGGATTGGGG + Intergenic
994129612 5:96210452-96210474 GTGCAAAAGCAATTCAATGGAGG - Intergenic
994709605 5:103250898-103250920 GTGCAAAAGCAATTCAATGGAGG - Intergenic
996136654 5:119850520-119850542 ATGCCAAAGTAATTCAATGGAGG + Intergenic
996326236 5:122277631-122277653 ATGCAAAAGTAATTCAATGGAGG + Intergenic
996952258 5:129141370-129141392 ATGAAAAAGTAATACCATGGGGG - Intergenic
999505551 5:152191783-152191805 GTGCAAAAGTAATTCAATGGAGG - Intergenic
999861550 5:155652906-155652928 GTGCAAAAGCAACTCAATGGAGG + Intergenic
1000933029 5:167275128-167275150 GTGCAAAAGCAATTCAATGGAGG - Intergenic
1001899264 5:175410472-175410494 ATGCAAAAGGAATTCAATGGAGG - Intergenic
1002014536 5:176309249-176309271 GTGCAAAAGCAATTCAATGGAGG + Intronic
1002629143 5:180557969-180557991 ATGCAAAAGCAATTCAATGAAGG - Intronic
1003856384 6:10280270-10280292 GTGCAAAAGCATCTCCATGGAGG + Intergenic
1003907131 6:10712183-10712205 ATGCAAAAGTATTTCAATAGAGG - Intergenic
1006726916 6:36205996-36206018 AGTCAAAAGTAACTCCAAGGTGG - Intronic
1007361991 6:41364726-41364748 ATGCAAAAGCAATTCAGTGGAGG + Intergenic
1010461487 6:76118911-76118933 ATACAAAAGTATCTTCATGGGGG - Intergenic
1011267415 6:85536839-85536861 ATTCAAAAGTACCACAATGGAGG - Exonic
1014558927 6:122866980-122867002 GTGCAAAAGCAATTCAATGGAGG - Intergenic
1016129651 6:140451160-140451182 ATGCAAAAGCAACTCAATGGAGG - Intergenic
1016246741 6:141991707-141991729 CTGCAAAAGCAATTCAATGGAGG - Intergenic
1017145930 6:151234858-151234880 GTGCAAAAGTAATTCAATGGTGG - Intergenic
1019208412 6:170383022-170383044 GTGCAAAAGCAACTCATTGGAGG + Intronic
1021443315 7:20704370-20704392 ATTCAAAAGTAAGGCGATGAAGG - Intronic
1021476072 7:21062533-21062555 ATGCAAAAGCAATTCAGTGGAGG + Intergenic
1022641748 7:32192453-32192475 ATGAAAAAGCAATTCAATGGAGG - Intronic
1023702714 7:42908475-42908497 ATGCAAAATTAAGTGTATGGGGG - Intergenic
1023866300 7:44239992-44240014 CAGCAAAAGTAACAGGATGGCGG + Intronic
1024048857 7:45604586-45604608 GTTCAAAAGTAATTCAATGGAGG - Intronic
1024496285 7:50050477-50050499 ATGCAAAAACAACTCAATGGAGG + Intronic
1025153219 7:56577113-56577135 AAGAAAAAGTAACTTTATGGTGG - Intergenic
1025764166 7:64427037-64427059 AAGAAAAAGTAACTTTATGGTGG + Intergenic
1030316353 7:108118503-108118525 GTGCAAATGCAACTCAATGGAGG + Intronic
1032555311 7:132826908-132826930 AGGCAAATGTAACTTAATGGGGG + Intronic
1033078906 7:138276225-138276247 ATGCAAAGGAAAGTCAATGGAGG + Intergenic
1034056441 7:148039808-148039830 ATGCCAAAGTAACAGGATTGAGG + Intronic
1034674754 7:152884393-152884415 AATCAAAAGTAACTAGATGGGGG - Intergenic
1035979231 8:4350791-4350813 TTGCTAAAGTAACTAGATGCTGG - Intronic
1038467985 8:27783862-27783884 AGGCAAAGGTAATTCCATGGAGG - Intronic
1038869088 8:31474259-31474281 ATGCCAAACTAACTGGATGATGG - Intergenic
1038934970 8:32239242-32239264 ATGCAAAAGTAATTCAATGGAGG + Intronic
1043080797 8:75762597-75762619 ATGCCAAAGTAATTCAATGAAGG + Intergenic
1046895789 8:119471233-119471255 ATACAAAAGCAATTCAATGGAGG + Intergenic
1047743366 8:127825368-127825390 ATGAGAAAGCAACTCCATGGAGG - Intergenic
1048471096 8:134704727-134704749 GAGCCAAAGTAACTCAATGGAGG + Intronic
1050474503 9:6026030-6026052 ATGCCAAAGTAATTCAATGGAGG - Intergenic
1050529037 9:6571929-6571951 TTGCAAAAGTAATTCAATGGAGG + Intronic
1052907752 9:33851674-33851696 AGGAAAAAGTAACTTGATAGTGG - Intronic
1053781341 9:41610429-41610451 ATCCAGAAGAAACTCAATGGTGG - Intergenic
1054169287 9:61820581-61820603 ATCCAGAAGAAACTCAATGGTGG - Intergenic
1054668248 9:67760234-67760256 ATCCAGAAGAAACTCAATGGTGG + Intergenic
1055578554 9:77684200-77684222 ATGCAAAAGAAATTCAATGAAGG - Intergenic
1056380876 9:86056268-86056290 ATGCATAAGTAAGTAGATAGGGG - Intronic
1059347761 9:113642340-113642362 ATGCCAAGGTAATTCAATGGAGG - Intergenic
1060526026 9:124321830-124321852 ATGCAAAAGCAAGGCGAAGGTGG + Intronic
1060624665 9:125100786-125100808 AAGCAAAAATAACTTGAAGGAGG + Intronic
1062209088 9:135353565-135353587 AAGCAAAAGTAGCTGGATTGCGG + Intergenic
1062241488 9:135542402-135542424 ATGCAAAAGTAATTCAGTGGAGG - Intergenic
1187352967 X:18538693-18538715 CTGCAAAAGGAACTCAATGGAGG - Intronic
1188363805 X:29289343-29289365 ATGCAAAAGCAATTCAATGGAGG - Intronic
1189493567 X:41489320-41489342 GTGCAAAAGTAAATCAATGGAGG + Intergenic
1189858702 X:45250239-45250261 ATGCAAAAGCAATTCAATGAAGG - Intergenic
1189859767 X:45260552-45260574 ATTCAAAACTAAATCAATGGTGG - Intergenic
1189963505 X:46348577-46348599 ATGCAAAAGAAATTCAATGAAGG + Intergenic
1192285018 X:69726481-69726503 AAGCAAAAGTAAATCTTTGGAGG + Intronic
1192332645 X:70190162-70190184 ATGAAAAAGCAATTCCATGGAGG + Intronic
1195734523 X:107998919-107998941 TTGCACAAGTAATTCAATGGAGG + Intergenic
1196352939 X:114754526-114754548 GTGCAAAAGTAATTCAATAGAGG + Intronic
1197625971 X:128802911-128802933 ATGCAAAAGTCACTAGATGGAGG + Intergenic
1198319063 X:135500599-135500621 ATGCAAAAGCAATTCAATGGAGG - Intergenic
1198389643 X:136161294-136161316 ATTCAAAAGTAACTGGATTAAGG - Intronic
1198715537 X:139554454-139554476 ATTCATAAGGAACTGGATGGAGG - Intronic
1198784857 X:140275790-140275812 GTGCAAAAGTAATTCAATGGAGG - Intergenic
1198868325 X:141149067-141149089 ATGCAACAGTAATTGGATAGGGG - Intergenic
1200278332 X:154755402-154755424 GTGCAAAAGCAATTCGATGGAGG + Intergenic