ID: 1127823305

View in Genome Browser
Species Human (GRCh38)
Location 15:62679944-62679966
Sequence ATGATGCAAAAGTAACTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127823305_1127823307 9 Left 1127823305 15:62679944-62679966 CCATCGAGTTACTTTTGCATCAT 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1127823305_1127823306 8 Left 1127823305 15:62679944-62679966 CCATCGAGTTACTTTTGCATCAT 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1127823306 15:62679975-62679997 TCTAGTTCAGCACATCTATATGG 0: 1
1: 0
2: 0
3: 4
4: 90
1127823305_1127823308 20 Left 1127823305 15:62679944-62679966 CCATCGAGTTACTTTTGCATCAT 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1127823308 15:62679987-62680009 CATCTATATGGGTCTATTTCTGG 0: 2
1: 4
2: 45
3: 261
4: 1006
1127823305_1127823309 21 Left 1127823305 15:62679944-62679966 CCATCGAGTTACTTTTGCATCAT 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1127823309 15:62679988-62680010 ATCTATATGGGTCTATTTCTGGG 0: 2
1: 21
2: 134
3: 493
4: 1847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127823305 Original CRISPR ATGATGCAAAAGTAACTCGA TGG (reversed) Intronic
900834907 1:4995015-4995037 AAGGTGCAAAAGTAAGTCAATGG + Intergenic
904865974 1:33579270-33579292 ATGATGGAAAAGAAACTTTAAGG - Intronic
905611979 1:39361064-39361086 ATGTTGAAAAAGTAACAAGAGGG + Intronic
905718977 1:40179465-40179487 ATCATGCAAAAGGAAGACGACGG - Intronic
908865410 1:68543251-68543273 ATGCTGCATAAGTTACTGGAGGG - Intergenic
908899052 1:68934811-68934833 AAGGTTCAAAAGTAACTGGAAGG + Intergenic
909170773 1:72291734-72291756 AAGATGCAAAAGCAATTCAATGG - Intergenic
909915161 1:81308824-81308846 ATGAGGCAAAAGAAACCCAAGGG - Intronic
911452918 1:98087919-98087941 ATGATCCAAAAGTAATCCAACGG - Intergenic
918288596 1:183083528-183083550 ATGATTCAAAAGAAACAAGATGG - Intronic
919620076 1:199854878-199854900 ATGTTGCAAAAGTGATTCAATGG - Intergenic
919877591 1:201881715-201881737 TTGATGCAAATGTGACTAGAAGG + Exonic
920289584 1:204909848-204909870 AAGATGCAAAAGCAAGTCAATGG - Intronic
921107639 1:211998438-211998460 AAGATGCTAAAGTAATTCAATGG + Intronic
923668145 1:236016761-236016783 ATGATCCAAAAGTACCTATAAGG + Intronic
1064733676 10:18359053-18359075 ATGATGGAAAAGTAACATGTTGG + Intronic
1065219269 10:23479500-23479522 ATTTTGCAAATGTAACTCAAGGG - Intergenic
1067677434 10:48395855-48395877 AAGATGCAAAAGTAATTCAGTGG + Intronic
1067767165 10:49095527-49095549 GGCATGCAAAAGTAACTCAATGG - Intronic
1071246149 10:83766608-83766630 AAGATGCAAAAGCAATTCAATGG - Intergenic
1075283849 10:121165834-121165856 ATGGTGGAAAATTAACTCGGAGG - Intergenic
1077664550 11:4095621-4095643 ATGAAGGGAAAGGAACTCGAGGG - Intronic
1078950177 11:16122695-16122717 ATTATGCACAAGTAACTTAAAGG + Intronic
1079426711 11:20350298-20350320 ATGATGCAACAGTAAAATGATGG + Intergenic
1079965352 11:26973380-26973402 AAGTTGCAAAAGTAATTCAATGG - Intergenic
1080032270 11:27674293-27674315 GGGATGCAAAAATAACCCGAAGG - Exonic
1085537826 11:77235551-77235573 AAGATGCAAAAGCAATTCAATGG + Intronic
1085615395 11:77994280-77994302 AGGATGCTAATGTAACGCGATGG + Intronic
1091621975 12:2095790-2095812 ATGATGCCAGAGAAACTGGAAGG + Intronic
1094483692 12:30906591-30906613 AAGGTGCAGAAGTAATTCGATGG + Intergenic
1095693683 12:45119805-45119827 TTGGTGCAAAAGTAACTGCAGGG + Intergenic
1098829292 12:75340323-75340345 AAGATGCAAAAGTAATTCAGGGG + Intronic
1101079760 12:101170928-101170950 ATGATGCAAAGCGAACTCAAGGG - Intronic
1105929179 13:25036068-25036090 AAAATGCAAAAGTAATTCAATGG + Intergenic
1107107315 13:36658752-36658774 ATGAAGCAAAAGAAAATCCAGGG - Intergenic
1108197072 13:48005653-48005675 AAGGTGCAAAAGTAATTCAACGG + Intergenic
1112566662 13:100557495-100557517 AAGATGCCAAAGTAATTCAATGG + Intronic
1117291013 14:54332873-54332895 ATGAAGCAACAGTAACGGGAAGG - Intergenic
1117548187 14:56809708-56809730 AAGATGCAGATGTAACTAGATGG - Intronic
1118100727 14:62599296-62599318 ATGATGCAAAAGGAGTTCTATGG + Intergenic
1120067247 14:80057107-80057129 ATGATTCAAATGTAAATCTAAGG - Intergenic
1120614238 14:86682819-86682841 GTGATACAAAAGTAATCCGATGG + Intergenic
1123785522 15:23667544-23667566 AAGGTGCAAAAGTAATTCAATGG - Intergenic
1123818180 15:24000530-24000552 ATTATGCAAAAGTTAGTCCAAGG - Intergenic
1124559936 15:30762304-30762326 GAGATGAAAAAGTAACTCAATGG + Intronic
1124608076 15:31186020-31186042 AAGGTGCAAAAGTAACTCAATGG + Intergenic
1126822483 15:52518375-52518397 AAAATGCAATAGTAACTCTAAGG + Intronic
1127823305 15:62679944-62679966 ATGATGCAAAAGTAACTCGATGG - Intronic
1128486988 15:68102226-68102248 AAGATGCAAAAGTAATTCAATGG - Intronic
1129101510 15:73269052-73269074 ATAAAGCAAAAGGAACTCAAGGG - Intronic
1130392217 15:83467302-83467324 AAGATGCAAAAGCAATTCAACGG - Intronic
1131978272 15:97968396-97968418 ATGTTGCAAAAGAATCTCCAGGG + Intronic
1136059382 16:27715272-27715294 CTTATGCAAAACTAACTCAATGG + Intronic
1137612075 16:49824896-49824918 CTGATGCAAAAGAAACTCGTGGG + Intronic
1138741911 16:59320887-59320909 ATATTTCAAAAGTAACTCTAGGG + Intergenic
1138884008 16:61053396-61053418 TTGATTCATAAGTAACTCAAGGG + Intergenic
1146524243 17:33552476-33552498 ATGATGGAAAAGTAACAACAGGG + Intronic
1150836264 17:68566902-68566924 AAGATGCAGAAGTAAATCCAAGG - Intronic
1153808307 18:8730067-8730089 ACAATGCAAAAGTAATTCGATGG - Intronic
1155418771 18:25630932-25630954 AAGATGCAAAAGCAACTTAATGG + Intergenic
1155627413 18:27850714-27850736 TTGAGGCAAAAGGAACTAGAAGG - Intergenic
1156592309 18:38504880-38504902 ATGATACAGAAGTAGCTCCAAGG + Intergenic
1162937948 19:13991064-13991086 GTGATGCAGAAGGAACTAGAAGG + Intronic
1166597759 19:44065380-44065402 ATGAATCAAAAGGAACTCTAAGG - Intronic
1167465668 19:49650018-49650040 ATGATGCCACAGTCACACGATGG - Intronic
926980756 2:18565066-18565088 ATAATGCAAAAGAAACACCAAGG - Intronic
928631474 2:33197501-33197523 ATGATGCAAAAATAAATTGGAGG - Intronic
934757843 2:96836990-96837012 AAGGTGCAAAAGTAATTCAATGG - Intronic
934908817 2:98231479-98231501 AAGGTGCAAAATTAACTCAATGG + Intronic
934969626 2:98752419-98752441 ATGTTTCACAAGTAACTGGATGG - Intergenic
935151865 2:100444455-100444477 AAGATGCAAAAGCAATTCTATGG - Intergenic
936975330 2:118215225-118215247 AGGATGCAAAGGTAATTCAATGG + Intergenic
937155243 2:119714392-119714414 ATGCTGAAAAAGTAAATTGAGGG + Intergenic
937628090 2:124066592-124066614 AGGATGTAAAAGTAACACCAAGG - Intronic
938784568 2:134614196-134614218 AAGATGCAAAAGCAATTCAATGG + Intronic
939699212 2:145369005-145369027 ATAATGCAAAAGGGACTCCAAGG + Intergenic
939724240 2:145695428-145695450 ATGATGCCAAGGTAGCTCAATGG - Intergenic
940135080 2:150426511-150426533 ATGATGAAAAATAATCTCGAAGG + Intergenic
941868112 2:170355654-170355676 ATGAATCAAAAGTAACTCAAAGG - Intronic
941873925 2:170414074-170414096 ATGGTGCAAAAGCAATTCAATGG - Intronic
946802967 2:223440635-223440657 AAGATGCAAAAGCAACTCAATGG - Intergenic
1169643566 20:7782328-7782350 AAGGTGCAAAAGTAACTGAAAGG - Intergenic
1170449873 20:16471692-16471714 ATGATGCAAAAGCAAGCTGAGGG + Intronic
1177778007 21:25591000-25591022 AAGATGCAAAAGTAACTCAGTGG + Intronic
1178142691 21:29701869-29701891 ATGATGCATAAGTAAGAGGAAGG + Intronic
1180088557 21:45521735-45521757 AAGGTGCAAAAGTAATTCAATGG + Intronic
1182728031 22:32464102-32464124 ATGATGCAAAACTAAGTAGGTGG + Intronic
1184427463 22:44420879-44420901 TTGATGAAAAATTCACTCGATGG - Intergenic
951935459 3:28017905-28017927 ATGAGGCAAAAATAAATCCAGGG - Intergenic
952867922 3:37868671-37868693 AAGATGCAAAAGAAATTCAAAGG - Intronic
953094653 3:39763159-39763181 AAGATTCAAAAATAACTCAATGG + Intergenic
953235107 3:41099511-41099533 ATGATGGCATAGTAACTCAATGG + Intergenic
954734704 3:52696719-52696741 ATAATGCAAAAGAAACCCTATGG + Intronic
955109851 3:55937565-55937587 ATGATGGAAAAGCACCTCCAGGG + Intronic
957507498 3:81141970-81141992 ATGTTGCAAAAGTAACACACAGG - Intergenic
959313024 3:104764991-104765013 ATTATGCAAAACTAACTCACTGG + Intergenic
960363240 3:116739756-116739778 ATGATGCTAATGTAACCTGATGG - Intronic
960786533 3:121378788-121378810 ATGTTTCAAAAGTAAATCGCTGG + Exonic
962144089 3:132821749-132821771 AGGCTGAAAAAGTAACTCCATGG - Intergenic
962286423 3:134089542-134089564 AAGATGCAAAAATAACTCAATGG + Intronic
964428365 3:156577113-156577135 ATGTTGAAGAAGTAACTCGGAGG - Intergenic
965887546 3:173466077-173466099 ATGATGCATGCGTAACTTGAGGG + Intronic
969975357 4:11094862-11094884 AGGATGCAAAAGCAATTCAATGG + Intergenic
970212523 4:13724981-13725003 AAGCTGCAAAAGTAATTCAATGG - Intergenic
970339346 4:15088115-15088137 ATGGTGCAAAAGTAATTCTGTGG - Intergenic
974566420 4:63582383-63582405 AAGATTCAATAGTAACTGGAAGG + Intergenic
974901734 4:68007662-68007684 AAGGAGCAAAAGTAACTCAATGG + Intergenic
975463626 4:74684383-74684405 AAGATGCAAAAGCAATTCAATGG - Intergenic
975803635 4:78089506-78089528 ATGATTCACATGTAACTCAAGGG - Intronic
977691111 4:99912141-99912163 AAGATGCAAAAGCAGTTCGATGG - Intronic
977827084 4:101545700-101545722 AAGATGCAAAAGCAATTCAATGG - Intronic
978616711 4:110604484-110604506 ATCATGCAAAAATAGCTCAAAGG + Intergenic
978993609 4:115120597-115120619 ATGATTCAAATATAACTCTAAGG + Intergenic
980207306 4:129736762-129736784 AAAATGCAAAAGTAACTCTGTGG + Intergenic
980910072 4:138986321-138986343 AAGATACAAAAGCAACTCAATGG - Intergenic
981285160 4:143008791-143008813 AAGATGCAAAAGCAATTCCAAGG + Intergenic
985165173 4:187086244-187086266 ATGATGCAGAAGTAATTCTCAGG + Intergenic
990091120 5:52050204-52050226 ATTATGCAAAAGTTTCTCAACGG - Intronic
992353374 5:75953975-75953997 TTGATGCCAAAGTAATTCAAAGG + Intergenic
995690508 5:114820679-114820701 ATGATGCAAAAGTAATTCAATGG + Intergenic
996136653 5:119850517-119850539 AAGATGCCAAAGTAATTCAATGG + Intergenic
996326235 5:122277628-122277650 AAGATGCAAAAGTAATTCAATGG + Intergenic
996412983 5:123179269-123179291 CTGATGCAAAAGCAAATGGAAGG - Intronic
996448329 5:123585188-123585210 ATGGTGCAAAAGCAACTCGAGGG + Intronic
996775642 5:127129577-127129599 ATGAAGCAACAGTAATTCAAAGG + Intergenic
999505552 5:152191786-152191808 AAGGTGCAAAAGTAATTCAATGG - Intergenic
999861549 5:155652903-155652925 AAGGTGCAAAAGCAACTCAATGG + Intergenic
1000638723 5:163675292-163675314 AAGATGCATAAGTAACTCAATGG + Intergenic
1001823497 5:174727383-174727405 ATAATTCAAATGTAACCCGAAGG + Intronic
1002088623 5:176791630-176791652 GTGATGAAAAAGTACCTGGAGGG - Intergenic
1003063309 6:2878963-2878985 ATTATGCAAAATTAAGACGAAGG + Intergenic
1004565790 6:16796180-16796202 ATGGTGCAAAAGTGATTCAATGG + Intergenic
1004792586 6:19043484-19043506 ATAGTGCAAATGTTACTCGAAGG - Intergenic
1006726917 6:36205999-36206021 AAGAGTCAAAAGTAACTCCAAGG - Intronic
1008800074 6:55356524-55356546 ATGATGCCACAGAAATTCGAAGG - Intronic
1009334529 6:62470332-62470354 ACATTGCAAAAGTAACTCGTTGG - Intergenic
1015359230 6:132318190-132318212 ATTCTGCAAAAGTAATTCCAAGG + Intronic
1016129652 6:140451163-140451185 AAAATGCAAAAGCAACTCAATGG - Intergenic
1017145931 6:151234861-151234883 AAGGTGCAAAAGTAATTCAATGG - Intergenic
1018675273 6:166215650-166215672 AAGATGCAAAAGCAATTCAATGG + Intergenic
1020688410 7:11324702-11324724 AAGATGCAAAAGCAATTTGATGG + Intergenic
1022608432 7:31840699-31840721 ATGATGCCAAATTAATTCAATGG - Intronic
1024496284 7:50050474-50050496 AAGATGCAAAAACAACTCAATGG + Intronic
1026122489 7:67550152-67550174 AAGATGCAAAACTAACTGGTAGG + Intergenic
1028569541 7:92271230-92271252 ATGGAGCAAAAGCAACTCAATGG - Intronic
1034674757 7:152884396-152884418 AAGAATCAAAAGTAACTAGATGG - Intergenic
1037247635 8:16854726-16854748 ATGATGCAAAAGCAATTCTGTGG + Intergenic
1038934969 8:32239239-32239261 AAAATGCAAAAGTAATTCAATGG + Intronic
1042107693 8:65346583-65346605 AAGATGCAAAAGCAATTCAATGG + Intergenic
1044713981 8:95083361-95083383 CTGATACAAAAATAACTAGATGG - Intronic
1046646991 8:116796041-116796063 AAGGTGCAAAGGTAACTTGAAGG - Intronic
1049012788 8:139898432-139898454 ATGATGCAGAAGAAACCTGATGG + Intronic
1049295605 8:141833584-141833606 AGGATGCCAAGGTAATTCGATGG - Intergenic
1050041626 9:1501117-1501139 AAGATGCAAAAGCAATTCAATGG - Intergenic
1050275958 9:4000700-4000722 AAGCTGCAAAGGTAACTGGAGGG - Intronic
1050474504 9:6026033-6026055 AAGATGCCAAAGTAATTCAATGG - Intergenic
1050529036 9:6571926-6571948 AAGTTGCAAAAGTAATTCAATGG + Intronic
1052456707 9:28708363-28708385 ATGATGCAAAACTAATCAGATGG - Intergenic
1054909420 9:70440342-70440364 ATGGTGCAAAAGTAACCCAAAGG - Intergenic
1057129726 9:92645444-92645466 AAAATGAAAAAGTAACTAGAGGG + Intronic
1057248689 9:93481635-93481657 AGGAGGCAAAAGGAGCTCGAAGG - Intronic
1058665307 9:107308617-107308639 AAGTTGCATAAGTAACTTGATGG + Intronic
1061819198 9:133215806-133215828 AAGATGCAAAAGCAATTCAATGG + Intergenic
1062241489 9:135542405-135542427 AAGATGCAAAAGTAATTCAGTGG - Intergenic
1188363806 X:29289346-29289368 AAGATGCAAAAGCAATTCAATGG - Intronic
1189493566 X:41489317-41489339 AAGGTGCAAAAGTAAATCAATGG + Intergenic
1194964592 X:100272812-100272834 AAAATGCAAAAGTAATTCAATGG + Intergenic
1196062229 X:111422115-111422137 AAGGTGCAAAAGCAACTCAATGG - Intergenic
1197625970 X:128802908-128802930 AAGATGCAAAAGTCACTAGATGG + Intergenic
1198217831 X:134572783-134572805 ATGATTCAAAATTATCTCGGGGG + Intronic
1198319064 X:135500602-135500624 AAGATGCAAAAGCAATTCAATGG - Intergenic
1199416721 X:147592699-147592721 AAGAAGCAAAAGTAATTCAATGG + Intergenic
1200277395 X:154747328-154747350 ATGTTTCAAAAGTAAATCAATGG + Intronic
1200278331 X:154755399-154755421 AAGGTGCAAAAGCAATTCGATGG + Intergenic
1200283356 X:154797536-154797558 AAGATGCAAAAGCAACTCAATGG + Intronic