ID: 1127823307

View in Genome Browser
Species Human (GRCh38)
Location 15:62679976-62679998
Sequence CTAGTTCAGCACATCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127823304_1127823307 12 Left 1127823304 15:62679941-62679963 CCTCCATCGAGTTACTTTTGCAT 0: 1
1: 1
2: 6
3: 31
4: 172
Right 1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1127823305_1127823307 9 Left 1127823305 15:62679944-62679966 CCATCGAGTTACTTTTGCATCAT 0: 1
1: 0
2: 2
3: 13
4: 159
Right 1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127823307 Original CRISPR CTAGTTCAGCACATCTATAT GGG Intronic
900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG + Intronic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
913243650 1:116852433-116852455 CCAGTTCAGGACATCTCTAAAGG - Intergenic
919505137 1:198388843-198388865 CTATTGCAGCACATCTATTCTGG + Intergenic
919986595 1:202680041-202680063 TTAGTTCAGTACAGCGATATGGG - Intronic
922457115 1:225784018-225784040 CTAGAGAAGCACATATATATGGG - Intronic
1063395923 10:5687335-5687357 CTAGTTAAGGATATCTATATAGG - Intronic
1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG + Intergenic
1081877049 11:46415679-46415701 CTAGTTTAGCCCATCTTTTTTGG - Intronic
1086806539 11:91250964-91250986 ATAGTTCTGCACATGTATACTGG - Intergenic
1088077502 11:105869021-105869043 CTAGTCCAGCAGATCTGTAAAGG - Intronic
1094212488 12:27907016-27907038 CTAGTTCCCCTCTTCTATATTGG + Intergenic
1095826822 12:46538501-46538523 CCATTTTATCACATCTATATTGG + Intergenic
1106027524 13:25969117-25969139 CCACTTCAGCATATCTAAATGGG + Intronic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1109146226 13:58783072-58783094 AGAGTTCAGATCATCTATATTGG - Intergenic
1109191960 13:59335726-59335748 CTATTTCAGCACAGCAATTTTGG + Intergenic
1109446954 13:62452729-62452751 ATATTTCAACACATCTACATAGG + Intergenic
1117712081 14:58541293-58541315 CTAGTGGAGCACATCTTTAATGG + Intronic
1119373804 14:74171548-74171570 CTAGTTCATAACATTTATTTAGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126249404 15:46550351-46550373 CCAGTGCAGCACAGCAATATTGG + Intergenic
1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG + Intergenic
1131518429 15:93095148-93095170 CCAGCTCAGCACAGCTATAATGG - Intergenic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1144759151 17:17697544-17697566 CATGTTCAGCACATCAATCTCGG - Intronic
1148224948 17:45892864-45892886 CTAGTTCAAGACCTCTATCTTGG - Intergenic
1150369623 17:64625713-64625735 CTAATTCAGTAGGTCTATATGGG + Intronic
1159733536 18:72063293-72063315 CTAATTCAGCACATTGACATTGG - Intergenic
926401447 2:12501129-12501151 CTTGTTCATCACATCTAAAGTGG - Intergenic
927462856 2:23313913-23313935 CTACTTCATCACACCAATATCGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
937271874 2:120658108-120658130 CAAGTTGAGCCCATCCATATTGG - Intergenic
938184147 2:129213234-129213256 CTAATCCCACACATCTATATGGG + Intergenic
940748333 2:157596078-157596100 GTAATTCAGTACATCTTTATTGG - Intronic
944176970 2:196841291-196841313 TTGGGTCAGCACATTTATATAGG - Exonic
945005949 2:205406467-205406489 TTAGTTCATCACATAAATATTGG + Intronic
945825471 2:214716246-214716268 CTATTTAAGCACACCTATATAGG - Intergenic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
948331200 2:237167119-237167141 CTGGTTCTGCAGATCTTTATAGG - Intergenic
1177470073 21:21548943-21548965 CTACTTCAGCCCATTTAAATAGG - Intergenic
951645232 3:24882796-24882818 CTGGTTAAGCACATGTCTATAGG - Intergenic
954214062 3:49114710-49114732 CTAGTTCAGCTCAGCTATTCTGG - Intronic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
958908522 3:99967957-99967979 GTACTTCAGCACATCTACTTGGG + Intronic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
962631195 3:137277762-137277784 CTAGCTCAGCACATCTTCATAGG - Intergenic
966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG + Intronic
967319760 3:188183924-188183946 CTAGTTCAGTCTATCTCTATGGG - Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG + Intronic
974101334 4:57421043-57421065 GTAGTTCAGAAAGTCTATATAGG - Intergenic
976654142 4:87469718-87469740 CTATTTCAACACCTCTAAATAGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977778045 4:100946121-100946143 CTAGTTTAGCAGATCTTAATTGG - Intergenic
978752402 4:112265294-112265316 CTATTGTATCACATCTATATGGG - Intronic
980639579 4:135559019-135559041 CAGGTTTAGCACATCTATCTTGG + Intergenic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
987639461 5:20594210-20594232 CTAATACAGCACATATGTATGGG - Intergenic
988329011 5:29810534-29810556 GTAGTTGCGCACATCTTTATAGG + Intergenic
991344720 5:65651627-65651649 CTGGTTTAGCACATTTATGTGGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1016729432 6:147412632-147412654 ATAGATAAGCACATATATATAGG + Intergenic
1020849257 7:13329758-13329780 TTAGTTATGCACATCTATTTAGG - Intergenic
1023299009 7:38748574-38748596 ATAGTTCAGCAGATTTATACCGG - Intronic
1031921442 7:127604165-127604187 CTATTTCACCACATCTACAGTGG + Intergenic
1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1044216442 8:89616638-89616660 ATAGTCCAGCACATTTATAGAGG - Intergenic
1045707492 8:104943087-104943109 CTACCTCAGCACATCTACTTTGG + Intronic
1046667295 8:117018438-117018460 CTTATTCAGCACATCTCAATTGG + Intronic
1050758790 9:9040454-9040476 CAAATTCTGCACATTTATATTGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1194424896 X:93724678-93724700 CTCATTCAACACATATATATAGG + Intergenic
1198821843 X:140656340-140656362 CTAGTACAGCACCTCAAAATTGG + Intergenic
1199538574 X:148931771-148931793 CTAGTTCAGAACACCATTATGGG + Intronic