ID: 1127827287

View in Genome Browser
Species Human (GRCh38)
Location 15:62715861-62715883
Sequence AGGTGGGGACAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2308
Summary {0: 1, 1: 3, 2: 19, 3: 236, 4: 2049}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127827287_1127827299 24 Left 1127827287 15:62715861-62715883 CCCTCTTCCCTCTGTCCCCACCT 0: 1
1: 3
2: 19
3: 236
4: 2049
Right 1127827299 15:62715908-62715930 TTCACATTTACCTGTGCCACAGG 0: 1
1: 0
2: 1
3: 7
4: 169
1127827287_1127827291 -10 Left 1127827287 15:62715861-62715883 CCCTCTTCCCTCTGTCCCCACCT 0: 1
1: 3
2: 19
3: 236
4: 2049
Right 1127827291 15:62715874-62715896 GTCCCCACCTGAGTTGATACTGG 0: 1
1: 0
2: 0
3: 3
4: 79
1127827287_1127827300 25 Left 1127827287 15:62715861-62715883 CCCTCTTCCCTCTGTCCCCACCT 0: 1
1: 3
2: 19
3: 236
4: 2049
Right 1127827300 15:62715909-62715931 TCACATTTACCTGTGCCACAGGG 0: 1
1: 0
2: 0
3: 22
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127827287 Original CRISPR AGGTGGGGACAGAGGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr