ID: 1127827513

View in Genome Browser
Species Human (GRCh38)
Location 15:62718049-62718071
Sequence CAGGAAATGAACCCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127827513_1127827515 1 Left 1127827513 15:62718049-62718071 CCTGGAGCAGGGTTCATTTCCTG 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1127827515 15:62718073-62718095 TTTCTAATAATTGCACCTCAAGG 0: 1
1: 0
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127827513 Original CRISPR CAGGAAATGAACCCTGCTCC AGG (reversed) Intronic
900622582 1:3594070-3594092 CAGGAACAGAACCCAGCTCTAGG - Intronic
901135264 1:6988940-6988962 CAGAGACTCAACCCTGCTCCTGG + Intronic
902567450 1:17321527-17321549 CAGGCAATTTACTCTGCTCCAGG - Intronic
904967137 1:34383913-34383935 CAGGAACAGAAGCCTGCTGCTGG + Intergenic
906790503 1:48654967-48654989 CAGTAATTGACCCCAGCTCCCGG + Intronic
908444997 1:64191581-64191603 CAGGGAAGGCACCCTCCTCCAGG + Intergenic
910186712 1:84549424-84549446 CAGGAAATGGACCCTGTCCCAGG - Intergenic
910358907 1:86395578-86395600 CAGGAAATAATTCCTTCTCCAGG - Intronic
912570264 1:110616239-110616261 CAGGAAGTGAAGCCTGGGCCAGG - Intronic
913427314 1:118747962-118747984 CAGCACATGAAACCTTCTCCAGG + Intergenic
916239712 1:162626660-162626682 AAGGATATAAACCCTTCTCCAGG - Intergenic
916899703 1:169207454-169207476 CAGGATAAGAACCTTGCTCTAGG + Intronic
917838276 1:178957891-178957913 CAGGACATGAGCCCAGCTCCAGG - Intergenic
918589530 1:186224629-186224651 CAGGAATTGTACCCTGAACCTGG - Intergenic
922532315 1:226353884-226353906 CTGGAGATGATCCCTGCCCCGGG + Intergenic
924482111 1:244445153-244445175 CCTGAGATGAAGCCTGCTCCTGG - Intronic
1063240425 10:4163747-4163769 CAGGTAATGATCGCTGCTCTCGG - Intergenic
1065303815 10:24349969-24349991 CAGGAATAGAATCCTGGTCCTGG + Intronic
1065747222 10:28853526-28853548 CAGGAAGTCCACCCTGCTTCTGG - Intronic
1065807432 10:29407837-29407859 CAGGAATTGTACCCTGAACCTGG + Intergenic
1067823105 10:49548361-49548383 CAGGAATTGAACCCTGAACCCGG + Intergenic
1069624620 10:69860169-69860191 CAGCAGATGAGCCCTGCTCCAGG + Intronic
1069661443 10:70126201-70126223 CAAGCAATCAACCCTCCTCCTGG + Intronic
1069723148 10:70562155-70562177 CAGGACCTGAACCCAGCTCATGG + Intronic
1071497906 10:86181131-86181153 CAGGGAACGTGCCCTGCTCCTGG - Intronic
1073037574 10:100574908-100574930 CAGGAAAAGAACCCTAGGCCAGG - Intergenic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1076920945 10:133454406-133454428 CAGGACCTCAGCCCTGCTCCAGG - Intergenic
1077236127 11:1482791-1482813 CAGGACATGGCCTCTGCTCCAGG + Intronic
1077408412 11:2392721-2392743 CAGCAAATCCACCCTGTTCCCGG - Intronic
1078959172 11:16243664-16243686 CAGGCAATCATCCATGCTCCTGG + Intronic
1079475906 11:20829197-20829219 CAGGAAATTGACCTTGCTGCAGG + Intronic
1081424125 11:42906402-42906424 CAGGACAGGGACCCTGATCCAGG + Intergenic
1083676275 11:64326999-64327021 CAGGTAAGGAGCCCTGCTCAGGG + Intergenic
1085297213 11:75437967-75437989 CAGGGACTGAACCCTGCTTGGGG + Intronic
1085742628 11:79090076-79090098 GAGGAAATTAAGCCTGCACCAGG + Intronic
1086062518 11:82714561-82714583 CAGGAAACGCAGCCTGCTGCAGG + Intergenic
1086377526 11:86216089-86216111 CAGGAAATGAAACCAACTTCTGG + Intergenic
1088927372 11:114315987-114316009 CATGAAATGACTCCTCCTCCTGG + Intergenic
1090394692 11:126411083-126411105 GAGGACCTGAACCCAGCTCCTGG + Intronic
1090454810 11:126839497-126839519 CAGGAAATGACTCCTGATCAGGG + Intronic
1090911705 11:131126427-131126449 CAGGACATGAAACATTCTCCAGG - Intergenic
1100867257 12:98870103-98870125 ATGGAAATGTACCCAGCTCCTGG + Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1102609343 12:114097702-114097724 AAGGAAATCCAACCTGCTCCAGG + Intergenic
1103072664 12:117957589-117957611 CAGGAAATGACCCATTCTCTGGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105344741 13:19561693-19561715 GAGGGATTGAACCCTGCCCCGGG + Intergenic
1105474189 13:20717045-20717067 CAGAAAAAGAGCCCTGCCCCTGG - Intronic
1107311495 13:39083119-39083141 CAGGAATTGAACCCTGCACCTGG - Intergenic
1108508001 13:51129969-51129991 CAGGAATTGAACCCTGAACCCGG - Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1110733718 13:78910367-78910389 AAGGAGATGAACCTTGCTCTTGG + Intergenic
1113330283 13:109319803-109319825 CAGCAAGTCTACCCTGCTCCGGG - Intergenic
1113371246 13:109727510-109727532 CCTGCAATGACCCCTGCTCCAGG - Intergenic
1113524099 13:110960451-110960473 CAGGAATTGAGCCCTGAACCTGG - Intergenic
1117656571 14:57961969-57961991 CTGGGCATGTACCCTGCTCCAGG - Intronic
1119230544 14:72975952-72975974 CAGGAGATGACACCTCCTCCAGG + Intronic
1121650718 14:95555857-95555879 CAAGAAATGATCCCTGGGCCGGG - Intergenic
1126950417 15:53874230-53874252 CAGGGAATTTACTCTGCTCCAGG + Intergenic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1129170547 15:73804884-73804906 CAGAAAATAAACCCTGAGCCTGG - Intergenic
1130197388 15:81793326-81793348 ATGGAAATGAACCCTGGCCCTGG + Intergenic
1132698810 16:1213570-1213592 CAGGAAAAGGACCCTGTTCTAGG - Intronic
1133099664 16:3471548-3471570 CAGGAAGTCATCCCTGCCCCAGG + Intronic
1137020419 16:35420136-35420158 CAGGAAAAGCAGCCTCCTCCTGG - Intergenic
1137929319 16:52571808-52571830 CATAAAATGAACCCTCCTGCAGG + Intergenic
1138557745 16:57782516-57782538 CAGGGTTTGAACCCAGCTCCAGG + Intronic
1140863859 16:79042365-79042387 CAGGCAAGAAACCCAGCTCCAGG - Intronic
1141482318 16:84314681-84314703 CAGGAACTGGCCGCTGCTCCAGG + Intronic
1141785649 16:86198788-86198810 CAGCAAAAGACCCCTCCTCCCGG + Intergenic
1141860386 16:86712344-86712366 CAGGTAATGCACCCAGCTGCGGG - Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142235827 16:88922099-88922121 CAGCCATTGAACCCAGCTCCCGG - Intronic
1144021568 17:11243027-11243049 CAGGGAACAAACCCTGCCCCGGG + Intronic
1144806445 17:17971533-17971555 CCAGAAATGCCCCCTGCTCCGGG - Intronic
1146582285 17:34049426-34049448 CAGGGAATGCAGCCTGTTCCTGG - Intronic
1146915304 17:36674476-36674498 CAGGAAATGAAGCCTTTTGCTGG + Intergenic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1148699754 17:49580333-49580355 CAGGAAATAAAGCTTGCCCCGGG + Exonic
1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG + Intronic
1149890982 17:60390763-60390785 CAAGAAATCAGCCATGCTCCAGG - Intronic
1150658017 17:67053294-67053316 CAGGATGGGAACCCTGCTCCAGG - Intronic
1150807984 17:68334291-68334313 CAGGGAATGAACCCATCTTCTGG + Intronic
1151691581 17:75689456-75689478 TAGGAAAGGAAGGCTGCTCCTGG - Intronic
1152645439 17:81466542-81466564 CAGGAAAGGGGCCCTCCTCCTGG - Intergenic
1152907808 17:82978564-82978586 CAGGAAATGAGACCTGCATCCGG - Intronic
1153093322 18:1372795-1372817 CAGGAAATGGACCCAGGGCCAGG + Intergenic
1155187364 18:23399118-23399140 CAGGACATCAACCCTGTGCCAGG + Intronic
1155850778 18:30770813-30770835 CAGGAATTGAACCCTAAACCTGG - Intergenic
1156194155 18:34754325-34754347 CAGGAAATCAACCCCTCTCATGG + Intronic
1156329347 18:36104804-36104826 CATGGACTGAACCATGCTCCTGG + Intergenic
1156359861 18:36375437-36375459 CAGGAGACAAACCCTGGTCCTGG - Intronic
1156368525 18:36451672-36451694 CAGGAACAGAGCCCTGCTCAAGG + Intronic
1157329102 18:46690236-46690258 CAGGAAATGAATCCTGTAACAGG - Intronic
1157560721 18:48643913-48643935 CTGGAAATGCTCCCTGCTACTGG - Intronic
1157582482 18:48781617-48781639 CAGGCCCTGAACCCTGCTGCTGG - Intronic
1157866601 18:51192324-51192346 CAGTAACTGAACCCTTCTCAAGG + Intronic
1158024742 18:52882688-52882710 CAGGACATGAACCATTCTCAAGG - Intronic
1159353112 18:67300172-67300194 CAGAAAAAGAACCCTCTTCCAGG + Intergenic
1160945711 19:1642840-1642862 GAGGAAATGACCCATGCGCCAGG + Intronic
1163067569 19:14810238-14810260 CTGGAAATGACCCCTCTTCCAGG + Intronic
927217748 2:20678027-20678049 CAGGAAATGAGCCCTGCTTGTGG - Intergenic
929114281 2:38431319-38431341 CTGAAGATGAACCATGCTCCTGG + Intergenic
930263639 2:49175000-49175022 CATGAAATGAGACCTGCTTCTGG + Intergenic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
933501137 2:83112993-83113015 AAAGAAATGAACCCTACTCATGG + Intergenic
934503410 2:94875326-94875348 CAGGACCTGAATCCTGCTCAAGG - Intronic
935064130 2:99633465-99633487 CAGGAAAGGAAAACAGCTCCAGG + Intronic
935836660 2:107062413-107062435 AGGGACATGGACCCTGCTCCTGG - Intergenic
936908509 2:117565846-117565868 CAGGACTTGAACTCTGCTCTGGG - Intergenic
937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG + Intergenic
941639559 2:167972499-167972521 CAGGAATTGAACCCTGAACCCGG - Intronic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
943320351 2:186436408-186436430 CAGGGAAGGAACCCTCCTCCAGG + Intergenic
945992601 2:216408647-216408669 CAGGAAAGGAGCCTGGCTCCAGG - Intergenic
948524370 2:238561033-238561055 CAGGGAATGGACCCTGGTCTGGG + Intergenic
1170646449 20:18200355-18200377 CAGCATATGAACCTTTCTCCAGG - Intergenic
1173092965 20:39993257-39993279 AAGGAAATGAATCCTATTCCAGG + Intergenic
1176146962 20:63569743-63569765 CAGGACCTGAACCCTGCACTTGG - Intronic
1177651359 21:23965074-23965096 CAGGGAAGGGACCCTCCTCCGGG - Intergenic
1178019911 21:28396135-28396157 CAGGGGATGAACCCTCCTCTGGG + Intergenic
1178435843 21:32557830-32557852 CAGGAATTGAACCCTGAACCTGG + Intergenic
1179790209 21:43752046-43752068 CAGAATCTGGACCCTGCTCCAGG - Intronic
1179794624 21:43775930-43775952 CAGGGACCGCACCCTGCTCCGGG + Intronic
1180041234 21:45281332-45281354 CATGAAATGAACCCAGTCCCAGG + Intronic
1181556691 22:23675419-23675441 CAGGAAATGGAGCCTTTTCCAGG + Intergenic
1181697696 22:24602166-24602188 CAGGAAATGGAGCCTTTTCCAGG - Intronic
1182255210 22:29032946-29032968 CAGTAAATGAACCCTGTGGCAGG + Intronic
1182731839 22:32502326-32502348 CAGGCAATGAGCTCTGCTCCAGG + Intergenic
1183018192 22:35007059-35007081 CAGGATTAGAACCCTGCTCAAGG + Intergenic
1184244234 22:43227808-43227830 CAGGGAATGAGCACTGCTCCAGG + Intronic
1185207521 22:49548668-49548690 CTGGGAATGAACCCTCATCCTGG + Intronic
950521743 3:13501634-13501656 CAGGACATGCCCCCTCCTCCAGG + Intronic
950668020 3:14509089-14509111 CGGGACGTGGACCCTGCTCCTGG - Intronic
952878580 3:37968874-37968896 CAGGAAAAGAGCCCTGGGCCAGG - Intronic
953844430 3:46416197-46416219 CAGCTAATCAACCCTTCTCCTGG + Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
957685740 3:83502086-83502108 CAGGGAAGGAACGCTCCTCCGGG - Intergenic
958142232 3:89576418-89576440 CTGGAAATGATTCCTGCTCATGG - Intergenic
961082175 3:124035603-124035625 CAGGAACTGAGCTCTGCTACGGG - Intergenic
962658319 3:137572383-137572405 GAGGATAGGAACCCTTCTCCAGG - Intergenic
964432998 3:156624812-156624834 CAGGGAAGGAACCCTCCTCAGGG + Intergenic
966192342 3:177282962-177282984 CAGGGAAGGAACCTGGCTCCTGG - Intergenic
966449444 3:180041213-180041235 AGGGAAATGAACTCAGCTCCAGG + Intergenic
966543277 3:181115975-181115997 AAGGAAATGCACCCTGGACCAGG - Intergenic
966721362 3:183065314-183065336 CAGGAACTGAATCCTGAACCCGG - Intronic
968062314 3:195735015-195735037 CAGTTAATGAGCACTGCTCCTGG + Intronic
969634665 4:8360152-8360174 CAGGAATTGAACCCTGAACCTGG - Intergenic
969899911 4:10339424-10339446 CAGGAAATGTTACTTGCTCCCGG - Intergenic
970712032 4:18875435-18875457 CGGGAATTGAACCCTGAACCAGG + Intergenic
971259110 4:25040279-25040301 CTGTAAATGAGCACTGCTCCTGG + Intergenic
971328968 4:25666466-25666488 CTGGAAATAGACCCTGCTGCTGG + Intronic
971555691 4:28011593-28011615 CAGGGAAAGAACCCTCCTCCGGG - Intergenic
974810780 4:66943267-66943289 AAGGAAATGAAACTTACTCCTGG + Intergenic
978182405 4:105814767-105814789 CTGGGAATGAACCCAGCTACAGG - Intronic
978261005 4:106759221-106759243 CAGGAGAGGAACCCTGATCTTGG - Intergenic
979713659 4:123810645-123810667 CAGGAAATGCACACTGTTTCTGG - Intergenic
980548468 4:134301912-134301934 CAGGAAAAGCACTCTGTTCCAGG - Intergenic
980778520 4:137466178-137466200 CAGGAATTGAACCCTGACCCCGG - Intergenic
983026955 4:162749896-162749918 CAGGAAATGTGCACAGCTCCAGG + Intergenic
983290142 4:165792027-165792049 CTTGAAATGAAATCTGCTCCTGG - Intergenic
984317073 4:178141435-178141457 CAGGGAAGGAACCCTTCTCCAGG + Intergenic
986684387 5:10263263-10263285 AAGGAGATGAACCCTGCTCTTGG + Exonic
986939995 5:12937713-12937735 CAGGGAAGGGACCCTCCTCCAGG + Intergenic
988716791 5:33836516-33836538 CAGGACAAGAACTCTGCTCTGGG + Intronic
988886377 5:35563046-35563068 CAGGAAAGGGACCCTGGACCTGG - Intergenic
988902299 5:35746025-35746047 CAGTAAGTCTACCCTGCTCCGGG - Intronic
993745552 5:91592780-91592802 CAGGAATTGAACCCTGAACCAGG + Intergenic
995014548 5:107295125-107295147 CAGGCAAAGAACCCTGGACCAGG + Intergenic
995075076 5:107973126-107973148 CAGGAAATGGAGCCTGTTCAGGG + Intronic
995454017 5:112333208-112333230 CAAGAAATGAAACCTGCTCAGGG - Intronic
995756770 5:115513518-115513540 AAGGAGATGAACCCTGCTCTCGG + Intergenic
996057877 5:119000622-119000644 AAGGAATTGAACCCTGAACCTGG + Intergenic
1000410793 5:160933864-160933886 CAGGGAAGGAACCCTTCTCCAGG - Intergenic
1000658044 5:163906080-163906102 CAGGAAGTGAACCTTCCACCAGG + Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1003275524 6:4647486-4647508 CAGCAAATGAAACCTGCCCGTGG - Intergenic
1003346608 6:5274602-5274624 CATGAAATGAACCCTGGAACTGG + Intronic
1004110948 6:12718269-12718291 CAGGCAATTTTCCCTGCTCCAGG + Intronic
1004426927 6:15513107-15513129 CAGGAAGTGAGGCCTGCTCGGGG - Intronic
1009908880 6:69902721-69902743 CAGGGAAGGGACCCTCCTCCAGG - Intronic
1013637673 6:112044596-112044618 CTGGAATAGAACCCAGCTCCTGG - Intergenic
1013671433 6:112407651-112407673 CAGTGAATGAACTCTGCCCCTGG + Intergenic
1013803072 6:113969909-113969931 CAGGAAATAGACCCTGCTTTGGG - Intronic
1014371869 6:120619729-120619751 CCTCAAATGAACCCTACTCCAGG + Intergenic
1014697061 6:124636001-124636023 CAGGACATGAAACATTCTCCAGG + Intronic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1015606781 6:134964952-134964974 CATGAAATGAACTCTACTTCTGG - Exonic
1017348623 6:153414344-153414366 CAGGAATTGAACCCTGATCCTGG + Intergenic
1018138057 6:160797236-160797258 CAGGAATTGAACCCTGAACCTGG - Intergenic
1018768066 6:166949719-166949741 CAGGAAAGGAGCCCAGCTTCTGG - Intronic
1019558983 7:1646600-1646622 CAGGGGATGGACCCTCCTCCAGG + Intergenic
1022486928 7:30786174-30786196 CAGGAAAGGAGGCCTGCTCAAGG - Intronic
1023873812 7:44276334-44276356 CAGAAAACGACCCCTGCTCAGGG - Intronic
1025223531 7:57136715-57136737 CAGAAATTGAACCCTGAACCCGG - Intronic
1025758100 7:64364229-64364251 CAGGAACGGAACCCTGCACAAGG + Intergenic
1028389057 7:90294519-90294541 CAGGAATTGAACCCTGGACCGGG + Intronic
1029777587 7:102694599-102694621 CCGGAACCGAACTCTGCTCCTGG - Intergenic
1030189830 7:106799993-106800015 CAGGAATTGAATCCTGAACCCGG + Intergenic
1030533669 7:110739771-110739793 CAGCAAATGAAACATTCTCCAGG + Intronic
1031515071 7:122690376-122690398 CAGGGAAGGAACCCTCCTCCGGG - Intronic
1031971584 7:128068620-128068642 CAGGAAATGAAACAAGTTCCTGG + Intronic
1032455838 7:132072783-132072805 CAGAAACTGAACCCAGCTCTGGG - Intergenic
1034461722 7:151201191-151201213 CAGGAACCGGTCCCTGCTCCTGG - Intronic
1035395211 7:158530473-158530495 CAGTGCATGAAACCTGCTCCAGG - Intronic
1036038914 8:5052468-5052490 CTGGAACTGAATCCTGCACCTGG - Intergenic
1037962024 8:23104982-23105004 CAGGAACTGAACTCAGCTCCAGG - Intronic
1037969430 8:23161427-23161449 CAGGAACTGAGCTCAGCTCCAGG + Intronic
1039152464 8:34522016-34522038 CAGGATAGGAAACATGCTCCAGG - Intergenic
1041700348 8:60781890-60781912 TAGGATTTCAACCCTGCTCCTGG - Intronic
1042352674 8:67793648-67793670 AAGAAAATGAACTCTTCTCCAGG + Intergenic
1042772984 8:72399073-72399095 CAGCAAAGGGACCCTGATCCTGG + Intergenic
1043624579 8:82240434-82240456 CAGGCATTGATCCCTTCTCCAGG - Intergenic
1044494720 8:92863078-92863100 CAGGCAATGAAACCCACTCCTGG + Intergenic
1044512708 8:93101220-93101242 CCTGACATGAACCCTGCACCAGG - Intergenic
1045428252 8:102088224-102088246 CAGGAATTGAACCCTGAAACTGG - Intronic
1045689867 8:104749177-104749199 CAGGAAATGGCCACTGCTACGGG - Intronic
1045742765 8:105381238-105381260 CAGGATATGAACCTTCATCCAGG - Intronic
1045921799 8:107538782-107538804 CAGGAAATGATGCCAGCTCTTGG + Intergenic
1050742211 9:8835155-8835177 AACGAAATGACCCCAGCTCCTGG + Intronic
1052368542 9:27640033-27640055 GAGCAAATGAACACTTCTCCTGG + Intergenic
1055336358 9:75236890-75236912 CAGGGAAGGAACCCTCCTCCGGG - Intergenic
1056111224 9:83397053-83397075 CAGTCAATGGACTCTGCTCCTGG - Intronic
1056305166 9:85283271-85283293 CAGGGACTGAACCATGCTCTGGG - Intergenic
1056791273 9:89626908-89626930 CAGGGAGTGAACACAGCTCCCGG + Intergenic
1057267894 9:93630956-93630978 CAGGAAATGCATCTGGCTCCAGG + Intronic
1058373669 9:104298788-104298810 CAGCAGATGAAACCTGCTGCAGG + Intergenic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1061890168 9:133615094-133615116 GAGCAGATGAACCCTGCTGCCGG + Intergenic
1185765597 X:2723537-2723559 CAGCAAACCAGCCCTGCTCCGGG + Intronic
1185856869 X:3544145-3544167 CTGGACATGAATCCTGCTGCTGG - Intergenic
1187736715 X:22312279-22312301 CAGGCAGTGAAGCCTGCACCAGG + Intergenic
1189049047 X:37624852-37624874 CAGGGAGTCAACACTGCTCCTGG + Intronic
1191793207 X:64992981-64993003 CAGGTATTGGACCCTGGTCCTGG + Intronic
1193363840 X:80607200-80607222 CAGGAATTGAACCCTAAACCTGG - Intergenic
1194138451 X:90177631-90177653 CGGGAATTGAACCCTGAACCTGG + Intergenic
1194912803 X:99667650-99667672 CTGGAAATTAACCCTCCACCAGG + Intergenic
1195892290 X:109709150-109709172 CAGGAAATTAAGCCTGCCCCAGG + Intronic
1197032633 X:121836103-121836125 CAGGAAACAAACTCTGTTCCAGG - Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic
1199553083 X:149078519-149078541 CAGGGAAGGGACCCTCCTCCAGG + Intergenic
1200807357 Y:7446309-7446331 CTGGACATGAATCCTGCTGCTGG + Intergenic