ID: 1127829166

View in Genome Browser
Species Human (GRCh38)
Location 15:62735183-62735205
Sequence GAAATTTCACAGATGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127829166_1127829168 -5 Left 1127829166 15:62735183-62735205 CCAGGCTTCATCTGTGAAATTTC 0: 1
1: 0
2: 0
3: 28
4: 232
Right 1127829168 15:62735201-62735223 ATTTCATGAGATGAGCTCTAGGG 0: 1
1: 0
2: 2
3: 15
4: 196
1127829166_1127829169 18 Left 1127829166 15:62735183-62735205 CCAGGCTTCATCTGTGAAATTTC 0: 1
1: 0
2: 0
3: 28
4: 232
Right 1127829169 15:62735224-62735246 TAAGCTGTTCAGCGATTCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1127829166_1127829167 -6 Left 1127829166 15:62735183-62735205 CCAGGCTTCATCTGTGAAATTTC 0: 1
1: 0
2: 0
3: 28
4: 232
Right 1127829167 15:62735200-62735222 AATTTCATGAGATGAGCTCTAGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127829166 Original CRISPR GAAATTTCACAGATGAAGCC TGG (reversed) Intronic
900662096 1:3789873-3789895 GAGATTTCACACATGAAGGGTGG + Intronic
902415144 1:16234102-16234124 TAAATTACACAGAGGAGGCCTGG + Intronic
903990821 1:27268148-27268170 GAAATTTCACAGGCGAGGCATGG + Intronic
904525762 1:31132716-31132738 AAAATTGCAAAGATGCAGCCAGG + Intergenic
907158370 1:52354409-52354431 GAAATCTCACAGAGGGACCCAGG - Intronic
907571353 1:55487114-55487136 GAGATTTCTCAGATGAACTCAGG + Intergenic
907773997 1:57494862-57494884 GGAATTTCACAGCTGAAGCAAGG - Intronic
908834172 1:68211882-68211904 AAAATTTCCCAGATGCAGCCAGG - Intronic
908968106 1:69791068-69791090 GAATTTCCACAGATGAAGTCTGG - Intronic
909821827 1:80073675-80073697 AAAATTTCATAGATGAGGCCAGG + Intergenic
910779418 1:90912688-90912710 GAAATATCACAGATGGGGACTGG + Intergenic
913098060 1:115538374-115538396 GTAATTTCACAGAGGACTCCTGG - Intergenic
916484070 1:165242325-165242347 GGATTTTCCCAGAGGAAGCCTGG - Intronic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
922022541 1:221718974-221718996 AAAGTTACACAGGTGAAGCCTGG + Intronic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
923580486 1:235206887-235206909 GAAATGTCACAGTAGAAGTCAGG + Intronic
924906227 1:248455472-248455494 GATATTTCATAAATGAATCCTGG - Intergenic
924921663 1:248636565-248636587 GATATTTCATAAATGAATCCTGG + Intergenic
1063626384 10:7693728-7693750 TAAATTTCCCAAATGAACCCTGG + Intergenic
1065093619 10:22260084-22260106 GACATTTTACAGAGGAAGACAGG + Intergenic
1065861019 10:29872448-29872470 GAATTTTCAGAGTTAAAGCCAGG - Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1069212765 10:65781648-65781670 GGAATGTCACAGATAAAGCCTGG + Intergenic
1069929851 10:71874988-71875010 TGAATTTCAAACATGAAGCCAGG + Intergenic
1070454417 10:76597264-76597286 AAAATTTCATAAAAGAAGCCTGG - Intergenic
1070907830 10:80089706-80089728 GAAATTTGTCAAATGCAGCCGGG + Intronic
1071989560 10:91088253-91088275 GAAATTTCAAATATAAATCCAGG - Intergenic
1072063598 10:91842402-91842424 GAAGTTTCACAGATTTAGGCTGG + Intronic
1073507774 10:104016021-104016043 GAAATTTTACAGTTGAGGCTGGG + Intronic
1076325567 10:129618048-129618070 GAAATTTCAGAGATGCCTCCAGG - Intronic
1077698085 11:4413381-4413403 TAAATTTAACTGGTGAAGCCAGG - Intergenic
1077822838 11:5767093-5767115 CAAAGTCCTCAGATGAAGCCAGG - Intronic
1079443269 11:20536194-20536216 GCAGTTTTGCAGATGAAGCCTGG + Intergenic
1080368290 11:31605069-31605091 TAAATCTGACAGATTAAGCCTGG - Intronic
1082172906 11:49027423-49027445 GGACTTTCACTGATGAAGTCAGG - Intergenic
1082607578 11:55260744-55260766 GGACTTTCACTGATGAAGTCAGG - Intergenic
1084017495 11:66393934-66393956 GAAATTTGACACAGTAAGCCAGG - Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1086692862 11:89808631-89808653 GGACTTTCACTGATGAAGTCAGG + Intergenic
1086703042 11:89921824-89921846 GGACTTTCACTGATGAAGTCAGG + Intergenic
1086712937 11:90031028-90031050 GGACTTTCACTGATGAAGTCAGG - Intergenic
1090550469 11:127814110-127814132 GAAATAAAAGAGATGAAGCCAGG + Intergenic
1092078264 12:5691425-5691447 CAAATTCCACAGATGAAGGCAGG + Intronic
1092583089 12:9868581-9868603 GAAATCTCAAAGATGTAGCTTGG + Intronic
1093109344 12:15130427-15130449 AAAAGTTAACAGATGAAGCCAGG + Intronic
1095208787 12:39468983-39469005 GTAATTTCTCAGATGAATCTAGG + Intergenic
1095683115 12:45001915-45001937 GAAATGTGACAGAAGGAGCCTGG - Intergenic
1095865808 12:46971123-46971145 GAAATTGTACAGATGATTCCAGG - Intergenic
1097634024 12:62100379-62100401 GAAATTTCAGAAATGAAGGCTGG + Intronic
1098097134 12:66970374-66970396 AAAATTACACAGATGAGGCTGGG - Intergenic
1098384589 12:69905420-69905442 GAAATTTCACATTTAGAGCCTGG - Intronic
1098580519 12:72094193-72094215 GAAAGTCCACAGATGACACCAGG + Intronic
1099514316 12:83577869-83577891 TAAATATCACAGAAGAGGCCTGG - Intergenic
1099655856 12:85489777-85489799 GAAATTTCAGAGATAAATCCCGG - Intergenic
1100409880 12:94305297-94305319 GAACTTTGCCAGATTAAGCCAGG - Exonic
1101115476 12:101527585-101527607 CAAATGTCACAGATAAAGACTGG - Intergenic
1101936258 12:109060211-109060233 GAACTTCCACAGATAAAGACTGG + Intronic
1104361277 12:128135521-128135543 GATTTTTCACAGATGAAGCAGGG - Intergenic
1104826914 12:131718050-131718072 CAAAAATCAGAGATGAAGCCGGG - Intronic
1106312648 13:28567412-28567434 GAAATTACAATGATGATGCCTGG + Intergenic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1107798606 13:44081536-44081558 TAAATTTCACAAATGGAACCTGG - Intergenic
1108185116 13:47880868-47880890 GAAATTTCACTCATGAACCAAGG - Intergenic
1110747380 13:79070225-79070247 TAAATGTCAGAGATAAAGCCTGG + Intergenic
1112623201 13:101073608-101073630 GAATTGTCACAGGTGAAGACTGG - Exonic
1114910372 14:27187253-27187275 GAAATTTGACTGATGAACTCTGG - Intergenic
1115104476 14:29744307-29744329 GAAAATTCAAAGATAAATCCAGG - Intronic
1115219223 14:31042916-31042938 GAAATTTTTCAGATGTAGCTGGG + Intronic
1115237687 14:31223840-31223862 AAAATTTTACAGATTAAGGCAGG + Intergenic
1116030513 14:39565534-39565556 GAGCTTTGACAGATGAAGGCTGG + Intergenic
1117601633 14:57381774-57381796 GGAATATCAGAAATGAAGCCTGG - Intergenic
1118352733 14:64985132-64985154 AAAATTTCAAAGATGAGGCTGGG - Intronic
1118605428 14:67499558-67499580 GATATTCCACAGACCAAGCCTGG - Intronic
1119002933 14:70899380-70899402 GAAATCTCTCACATGGAGCCTGG - Intergenic
1119077427 14:71656067-71656089 GAAGTTTCAGAGATGAAACTAGG - Intronic
1120607472 14:86596842-86596864 CAAAGTTCACAGATACAGCCAGG + Intergenic
1124459162 15:29873067-29873089 GGGATTTCACAGATGAAAACTGG + Intronic
1126837019 15:52678561-52678583 GTAATTACACAGGTGAGGCCCGG - Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1131496348 15:92914535-92914557 TAAAATTCACAGCTGAAGCCAGG - Intronic
1134409557 16:13992745-13992767 GAAAGTGCAAAGTTGAAGCCTGG + Intergenic
1135009799 16:18865150-18865172 AAAATTTCACAGATTAACACAGG + Intronic
1135141032 16:19922149-19922171 GAAATTTTAAAAATGTAGCCAGG - Intergenic
1135657612 16:24264919-24264941 AAAATTTCTGAGATGAAGCATGG - Intronic
1136313503 16:29432782-29432804 GAAATTTCACAGATTAACACAGG + Intergenic
1136326944 16:29534547-29534569 GAAATTTCACAGATTAACACAGG + Intergenic
1136441635 16:30274532-30274554 GAAATTTCACAGATTAACACAGG + Intergenic
1137390567 16:48077921-48077943 GAAAGCTCTCAGCTGAAGCCAGG + Intergenic
1139381902 16:66537777-66537799 GAAAGTTCCCAGATGGATCCTGG - Intronic
1139888427 16:70228264-70228286 AAAATTTCACAGATTAACACAGG + Intergenic
1140438369 16:74967314-74967336 TAAATTGCACAGAGGAATCCTGG - Intronic
1140456665 16:75109722-75109744 GATATTTCACATGTGAAGCGGGG + Exonic
1140766448 16:78163840-78163862 GTGATTTCAAAGATGAAGACTGG - Intronic
1141629590 16:85279945-85279967 GTAATTTCACTGATAAACCCTGG - Intergenic
1143289148 17:5815844-5815866 GAAATTTGAAAGATCAAGCAAGG - Intronic
1154093524 18:11387739-11387761 GAAATTTCAGAGATGAGCCTGGG - Intergenic
1155170303 18:23262327-23262349 GACATTGCTCAGATGAGGCCTGG + Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1157713448 18:49865839-49865861 GAAATGTCACAGATGTGCCCTGG - Intronic
1161132143 19:2596960-2596982 GAAATTTCACAGGTATAGGCTGG + Intronic
1166676615 19:44745266-44745288 GAAACTTCCCAGAGGAGGCCAGG - Intergenic
926729679 2:16026711-16026733 GAAATTTCACAGCTGATTCAAGG - Intergenic
927283394 2:21331515-21331537 GAAAATACACAGATAAAGTCTGG - Intergenic
928724527 2:34156589-34156611 GAAAATTGAGAGATGAACCCTGG + Intergenic
929400729 2:41578269-41578291 AAAATTTCACAGCTGGGGCCGGG - Intergenic
930073057 2:47383930-47383952 GAAATTTAACAGTTTAGGCCAGG - Intronic
930441996 2:51420593-51420615 GAAAAATCACCCATGAAGCCAGG + Intergenic
930580836 2:53209907-53209929 GACAGTTCACAGAGGGAGCCAGG - Intergenic
930992833 2:57680965-57680987 AAAATTTCGCAGCTGAATCCAGG - Intergenic
932858230 2:75261585-75261607 GAATTTTCAGAGCTAAAGCCAGG - Intergenic
932899157 2:75678101-75678123 GCATTTTTACAGATGAAGCTGGG - Intronic
933369174 2:81393558-81393580 GAATCTGCATAGATGAAGCCAGG - Intergenic
935857434 2:107290190-107290212 GTAGTTTCACAGAGAAAGCCAGG - Intergenic
935861557 2:107336737-107336759 GGAATTTCACAGAGGAACACTGG + Intergenic
936097025 2:109538208-109538230 GAGATGTGACAGCTGAAGCCAGG - Intergenic
937417409 2:121726807-121726829 AAAATTTTAAAAATGAAGCCAGG - Intergenic
937880568 2:126861433-126861455 GAACTTTGAAAGAGGAAGCCAGG + Intergenic
938211117 2:129466433-129466455 GAAATCTGACCGATGAGGCCGGG + Intergenic
939728344 2:145751671-145751693 GAAATTTAACACATAAACCCTGG - Intergenic
939731660 2:145792604-145792626 GGAATCTCACAGGTGAAGCAAGG - Intergenic
939881024 2:147631587-147631609 GAAACTTCACAGCTAGAGCCTGG + Intergenic
941111972 2:161426227-161426249 TAAATTTCACAGAGTAAGGCGGG + Intronic
941390216 2:164903898-164903920 GAAATTTCTCAAATGATGCAAGG + Intronic
941607616 2:167619740-167619762 GAAATTTCACAGTTGACAACTGG - Intergenic
944738292 2:202588066-202588088 GAAATTTAGCAGAAGAAGACAGG - Intergenic
944870693 2:203908862-203908884 CCCATTTCACAGATGAAGACTGG - Intergenic
946288730 2:218726760-218726782 GAAATTTCACAAAAGAGGCCAGG - Intronic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947629044 2:231639920-231639942 TAAAATTCACAGAAGAGGCCGGG - Intergenic
948261707 2:236608953-236608975 GAAATTTTACAGAGGATTCCAGG + Intergenic
948420158 2:237853967-237853989 GAACTGTCACAGATGAAGGATGG - Intergenic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171979126 20:31614455-31614477 GAAATTTCCAAGATTAGGCCAGG - Intergenic
1172538177 20:35690350-35690372 GAAATTTACAAGCTGAAGCCAGG + Intronic
1173529333 20:43756615-43756637 AAAATAGCACAGATGAAGGCTGG + Intergenic
1173628650 20:44492806-44492828 GAAATTCAAGACATGAAGCCAGG - Exonic
1177185989 21:17796877-17796899 GAAATTAAACAGATGATGCTGGG + Exonic
1177882150 21:26707059-26707081 GAATTCTCACTGATAAAGCCAGG - Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1180893374 22:19308482-19308504 GAAATTTGGCAGTTGAAGGCCGG + Intergenic
1182114990 22:27751272-27751294 GAGATCTCACAGATGAATCAGGG - Intronic
1183163258 22:36128812-36128834 GAAATCACACAGAAGAGGCCAGG + Intergenic
1183472734 22:38018158-38018180 GAAAGTTCACAGATGAGCCCTGG - Intronic
1184297441 22:43533841-43533863 GACATTTCACAGATGAGTCCTGG + Intronic
1184925551 22:47634074-47634096 GAAATTACCCCCATGAAGCCAGG - Intergenic
1184935867 22:47720016-47720038 GAACTTCCAGAGATGAGGCCGGG + Intergenic
949404963 3:3704645-3704667 GAAATTTCATACATTTAGCCTGG + Intronic
953668785 3:44945231-44945253 GAGAGTTTACAGTTGAAGCCTGG - Exonic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
957856449 3:85885239-85885261 AAAATTTTACAAATGAGGCCAGG + Intronic
958777930 3:98507698-98507720 TAAATTTAAGAGATGAGGCCAGG - Intronic
960576686 3:119237043-119237065 GGAAATCCACACATGAAGCCAGG + Exonic
961116067 3:124331096-124331118 TTGATTTCACAGATGAAACCAGG - Intronic
961227235 3:125262534-125262556 GAAATTTCACATATAAACACTGG + Intronic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
963132081 3:141867494-141867516 TAAATTTCACATTTGAGGCCAGG + Intergenic
965394004 3:168139991-168140013 GAATTTTCAGTGAAGAAGCCAGG + Intergenic
965478865 3:169191397-169191419 AAAACTTCCCAGATGAAGGCAGG + Intronic
966611912 3:181875936-181875958 GAAAATTCTCAGCTGGAGCCTGG - Intergenic
966723935 3:183091664-183091686 ATAATTTTACAGATGAAGCAAGG + Intronic
967370946 3:188745417-188745439 GAAAATTCACAAATGAATACAGG - Intronic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
969710045 4:8837549-8837571 GAAATTTCCCAAACAAAGCCAGG - Intergenic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
972653324 4:41041173-41041195 AAAATTTCACACATGTAGCCGGG - Intronic
972871562 4:43306262-43306284 GAAATTTCCCATATGAAACTTGG - Intergenic
973955641 4:56060468-56060490 GAAATGTAACAGATGGAGGCAGG + Intergenic
975531009 4:75399430-75399452 GGAATTTCACACATAAAACCTGG - Intergenic
975671039 4:76781017-76781039 GAAATTCCTCAGAGGAATCCAGG + Exonic
977394728 4:96455822-96455844 TCCATTTCACAGATGAAGTCTGG - Intergenic
977778128 4:100947494-100947516 GAAATCTTTCAGATGAAACCTGG - Intergenic
978981104 4:114946571-114946593 GAGACAGCACAGATGAAGCCTGG + Intronic
979534992 4:121809280-121809302 TAAATTACACATATGAGGCCAGG - Intronic
980464725 4:133157946-133157968 AGAATTTCACACATGGAGCCAGG - Intronic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
982743972 4:159087129-159087151 GGAATTTCACAGGTGAACCAAGG + Intergenic
984407551 4:179352562-179352584 GAAATTGCTCAGAGGAAACCTGG - Intergenic
985406571 4:189644762-189644784 GAAATTTCACAGGTGAAAGGCGG + Intergenic
985425781 4:189828767-189828789 GAAATCTCACAGAGGAGGCGAGG - Intergenic
986565130 5:9105297-9105319 GAAATTTCACAAGTGAAGCTGGG + Intronic
986956429 5:13156280-13156302 GAAATTACAGAGATAAGGCCAGG + Intergenic
991021525 5:61984435-61984457 AGAATTTCACAGATGAAGAGGGG + Intergenic
992282983 5:75201190-75201212 TAAATTGCAAAGATGAAGCGAGG - Intronic
994168858 5:96637555-96637577 GACATTAAACAGATGAAGACTGG + Intronic
994874299 5:105395977-105395999 GAAATATCACAGATGAGTACCGG + Intergenic
995629116 5:114113886-114113908 GAGATTTCACAGAAGCTGCCAGG - Intergenic
996049463 5:118915667-118915689 TAAATTTCAAAGATTAGGCCGGG - Intronic
997508421 5:134436558-134436580 CAGATTTCCCAGATGAAACCTGG - Intergenic
999176438 5:149635142-149635164 GAAATCAGACAGATGAGGCCCGG + Intergenic
999566126 5:152863919-152863941 GAAAAGTCACAGCTGAATCCAGG - Intergenic
999686689 5:154109478-154109500 GAAATTTCACATACAAATCCAGG + Intronic
999960082 5:156745130-156745152 GAGATTTCACAGATGAAACTGGG + Intronic
1000542004 5:162551546-162551568 GAAATTTCCCAGATGGATCTTGG + Intergenic
1000785356 5:165536309-165536331 AAAATCTCACGGATGGAGCCTGG + Intergenic
1000820296 5:165974111-165974133 AAAATTTCACAGATGAGTTCTGG - Intergenic
1001126040 5:169020342-169020364 GAAGTTTCACGGACCAAGCCAGG - Intronic
1001197906 5:169690311-169690333 GAAATTACAGAGAAGGAGCCAGG + Intronic
1001413690 5:171528442-171528464 GAAATTTCACATAAAAATCCAGG - Intergenic
1003987264 6:11449261-11449283 GAAATTTCCCAGGTTAAGCTAGG + Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004585283 6:16993813-16993835 GAAATTTAACAGGAGAAACCAGG + Intergenic
1006421216 6:33935395-33935417 CTACTTTCACAAATGAAGCCTGG + Intergenic
1007528212 6:42515515-42515537 GAAATTTCAATGCTAAAGCCAGG + Intergenic
1009298438 6:61984342-61984364 GAAATTTCACAAAAAAAGCTAGG - Intronic
1013671651 6:112409477-112409499 GAAATTTGAGAGATGATGTCAGG - Intergenic
1013796969 6:113899056-113899078 GAAATTGCCAAGATGAAGGCAGG - Intergenic
1014226375 6:118852569-118852591 GCAAGTTCACAGCTGAAGCTTGG - Intronic
1016140465 6:140602674-140602696 GAAAGTTGACAGATGACGACAGG + Intergenic
1016604723 6:145907217-145907239 GAAATTTCATAGATCACCCCTGG - Intronic
1017860784 6:158395214-158395236 GAAATTTTACAGATCAACCCAGG - Intronic
1018389205 6:163329917-163329939 GAAACTTTAGAGATCAAGCCTGG - Intergenic
1020720399 7:11737374-11737396 GACCTTTCACACATCAAGCCTGG - Intronic
1024667444 7:51560777-51560799 AAAATTTCACAGCTGAAAGCAGG + Intergenic
1025242122 7:57285815-57285837 AAAATTCCACTGATGAAGCCAGG - Intergenic
1025983682 7:66428936-66428958 GAAGTTTCACAGCTGAAGTGAGG - Intergenic
1026039358 7:66854294-66854316 GAATTTTAACAAATGAGGCCGGG - Intergenic
1028879323 7:95861847-95861869 TAAATCTCACAGATGAAGGATGG - Intronic
1029292034 7:99509417-99509439 GAAATTTCACAGATATGGTCAGG - Intronic
1032057603 7:128696312-128696334 GAAGTTCCACAGAAGCAGCCAGG - Intergenic
1032644188 7:133803309-133803331 AACATTTCTCAGATGAAACCAGG + Intronic
1034390617 7:150784793-150784815 CAAACTTCACAGAGAAAGCCTGG - Intergenic
1037070852 8:14646959-14646981 CACATTTCAGAAATGAAGCCTGG + Intronic
1039098796 8:33917856-33917878 GACATTTTACAGATAAAGCAAGG + Intergenic
1039402323 8:37280045-37280067 GAGATGTCACTGAAGAAGCCTGG - Intergenic
1040082020 8:43295027-43295049 GAAAGTTCACAGAAGAGGCCAGG - Intergenic
1040671490 8:49696876-49696898 GAAATTTCACAGCTTATTCCAGG + Intergenic
1042025026 8:64414222-64414244 GAAATTTCACAGTTAAATTCAGG + Intergenic
1042158496 8:65868674-65868696 GTAATTTGACTGATGAAGGCGGG - Intergenic
1043133275 8:76488549-76488571 GAAATTACACATATGAATTCAGG - Intergenic
1044121415 8:88401154-88401176 GAAACTGCACTGAAGAAGCCTGG - Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1047063919 8:121259288-121259310 TTATTTTCACAGATGTAGCCTGG + Intergenic
1047623913 8:126636112-126636134 GTAATTTCTCAGATGCTGCCAGG - Intergenic
1048607111 8:135980763-135980785 GAAATTTCACAAATGAAAAATGG - Intergenic
1049924662 9:397114-397136 CAAATTACACACATGAGGCCAGG + Intronic
1050422902 9:5485284-5485306 GATATGTCAGACATGAAGCCCGG - Intergenic
1050437404 9:5625657-5625679 GATATTTGAAAGTTGAAGCCAGG + Intergenic
1051155821 9:14144759-14144781 GAAATTTCTCAGTTTAAGCTGGG + Intronic
1051416640 9:16848284-16848306 GAAATTCCATCGATGAAGTCAGG + Intronic
1051505655 9:17824882-17824904 GAAATCTCAGAGATGAAGGGTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1186395851 X:9208382-9208404 GAAATTTAGCATATAAAGCCGGG + Intergenic
1187889455 X:23920594-23920616 GAAAATTATCAAATGAAGCCAGG + Intronic
1188645830 X:32565894-32565916 GAAAGATCACAGAATAAGCCTGG + Intronic
1191118053 X:56871571-56871593 GAAAGTTAACAGATAAATCCAGG + Intergenic
1192089523 X:68138934-68138956 TTAATTTTACAGATTAAGCCAGG - Intronic
1193495669 X:82208506-82208528 CAAGTTTCACAGAGGAAGCAAGG - Intergenic
1194721396 X:97344247-97344269 AAAATTTCCCACATGAAGCCAGG + Intronic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1196917920 X:120557999-120558021 AAAACTACACAGATGAAACCTGG - Exonic
1197609301 X:128621203-128621225 GAAGTTTCCCATCTGAAGCCTGG + Intergenic
1197903497 X:131398433-131398455 GGAATGTCACAGAAGAAGGCAGG + Intronic
1198407723 X:136331711-136331733 GACATTTCACTGATGAACACAGG - Intronic
1200844477 Y:7817293-7817315 GAAATTACATACATGAAACCAGG - Intergenic