ID: 1127832072

View in Genome Browser
Species Human (GRCh38)
Location 15:62759753-62759775
Sequence ATGTAGCCACTGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127832065_1127832072 7 Left 1127832065 15:62759723-62759745 CCAGCTGAAGGGGTATGATTGGA 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG 0: 1
1: 0
2: 6
3: 35
4: 356
1127832063_1127832072 8 Left 1127832063 15:62759722-62759744 CCCAGCTGAAGGGGTATGATTGG 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG 0: 1
1: 0
2: 6
3: 35
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127832072 Original CRISPR ATGTAGCCACTGGTGGGGCT GGG Intronic
900628110 1:3618756-3618778 ATGGAGCCAGGGCTGGGGCTTGG - Intergenic
901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG + Intergenic
901904415 1:12395239-12395261 ATGTTGCCACTACTGGGGATGGG + Intronic
902722016 1:18310046-18310068 ATGCAGCCACAGGCGGGACTGGG - Intronic
903134928 1:21303076-21303098 AAGCAGCCAGTGGTGGGGCTGGG - Intronic
904335562 1:29795396-29795418 ATGTTGCCACTACTGGGGATGGG - Intergenic
904494349 1:30878284-30878306 CTGTGGCCAATGGTGGGGTTAGG - Intronic
905956311 1:42000220-42000242 AGGTAGCTTCTGGTGGGCCTAGG + Intronic
906538652 1:46567732-46567754 ATTTAGGCACTGGTGGTGTTGGG - Intronic
906867729 1:49440925-49440947 ATGTTGCCACTACTGGGGATGGG - Intronic
906879347 1:49573900-49573922 ATGTTGCCACTACTGGGGTTGGG - Intronic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
907474024 1:54693492-54693514 TTATAGTCACTGGTGGGGCAGGG + Intronic
907633348 1:56106869-56106891 ATGTGGCCACTGTGGGGGATGGG - Intergenic
907779989 1:57558196-57558218 ATGTTGCCACTACTGGGGATGGG - Intronic
908616602 1:65929294-65929316 ATGTTGCCACTACTGGGGATGGG + Intronic
909549303 1:76879736-76879758 ATGTTGCCACTACTGGGGATGGG + Intronic
909576557 1:77183290-77183312 ATGTTGCCACTGCTGGGGATGGG - Intronic
909902963 1:81160868-81160890 ATGTGGCCACTGCTGGGGGATGG - Intergenic
910229740 1:84973937-84973959 AGGTGGCCACTGCTGGGGCTGGG - Intronic
910639318 1:89442543-89442565 ATGTTGCCACTACTGGGGATGGG + Intergenic
911883225 1:103267894-103267916 ATGTTGCCACTACTGGGGATGGG - Intergenic
911982223 1:104581851-104581873 ATGTTGCCACTACTGGGGATGGG + Intergenic
912071046 1:105809968-105809990 ATGTTGCCACTACTGGGGATGGG + Intergenic
912212324 1:107569443-107569465 CTGTAGCCAATGGTTTGGCTGGG + Intergenic
912252184 1:108022380-108022402 ATGTTGCCACTACTGGGGGTGGG + Intergenic
912944176 1:114070752-114070774 ATGTTGCCACTACTGGGGATGGG + Intergenic
915466169 1:156099307-156099329 AAGCAGCCAGTGGTGGAGCTAGG - Intronic
915668011 1:157462232-157462254 ATGTTGCCACTAATGGGGATGGG + Intergenic
916097119 1:161361065-161361087 ATGGCGCCACTGGAGTGGCTGGG + Intronic
917498601 1:175565291-175565313 ATGTCACCTCTGGTGGGGATGGG - Intronic
918154992 1:181836055-181836077 CTGCAGCTACTGGTGGGGATAGG - Intergenic
918756065 1:188340379-188340401 ATGTTGCCCCTGCTGGGGATGGG + Intergenic
918957924 1:191235448-191235470 ATGTTGCCACTACTGGGGTTGGG - Intergenic
919230355 1:194765138-194765160 ATGTTGCCACTATTGGGGATAGG + Intergenic
919241460 1:194921930-194921952 ATGTTGCCACTACTGGGGATGGG - Intergenic
920607050 1:207399040-207399062 CTGGAGCCAGTGGTGGGGGTGGG + Intergenic
922216524 1:223524447-223524469 ATGTAGCTACTGGTCAGGCATGG - Intergenic
922755258 1:228093058-228093080 AAGTAGCCACTGGTGGCTCCTGG + Intronic
922807893 1:228400075-228400097 ATTCAGCCACTGGTGGGGCAGGG - Intronic
923215217 1:231842755-231842777 ATGTAACCAATGGTGGGTCCAGG + Intronic
924847532 1:247788110-247788132 ATGTTGCCACTACTGGGGATGGG + Intergenic
1062770838 10:99256-99278 ATGTTGCCACTACTGGGGATAGG + Intergenic
1062900551 10:1142003-1142025 AGTGAGCGACTGGTGGGGCTGGG + Intergenic
1063495084 10:6499822-6499844 ATCTAGCCACTGTTAGGGATTGG - Intronic
1066543376 10:36473886-36473908 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1067152644 10:43749283-43749305 ATGTTTCCACTGGAGTGGCTGGG + Intergenic
1067754757 10:48996632-48996654 ATGTTGCCACTACTGGGGATGGG + Intergenic
1068446863 10:57136004-57136026 ATGTTGCCACTATTGGGGATGGG - Intergenic
1068837589 10:61571173-61571195 ATGTTGCCACTAATGGGGATGGG + Intergenic
1068958811 10:62845696-62845718 ATGTTGCCCTTGGTGGGCCTGGG + Intronic
1069192662 10:65508934-65508956 ATGTTGCCACTACTGGGGGTGGG + Intergenic
1069251122 10:66268447-66268469 ATTTAGCCTCTTATGGGGCTTGG - Intronic
1069791219 10:71022318-71022340 ATGTTGCCACTACTGGGGATGGG + Intergenic
1070088767 10:73262731-73262753 AGGTATCCACTGGGGGGTCTTGG + Intronic
1071267446 10:83976572-83976594 ATGTTGCCACTACTGGGGATGGG + Intergenic
1071378044 10:85030838-85030860 ATGTTGCCACTACTGGGGATGGG - Intergenic
1071901470 10:90124813-90124835 ATGCAGACACTGGTGGGGAAAGG - Intergenic
1072360545 10:94654733-94654755 CTGTAGCCAATGGTTTGGCTGGG + Intergenic
1073203124 10:101752479-101752501 CTGTGGCCACTGGTGGCCCTAGG + Intergenic
1074402935 10:113156824-113156846 ATCTAGCAAGTGGTGGGGCCAGG - Intronic
1074567286 10:114592067-114592089 ATGTAGGCACCAGTGGGGCAGGG - Intronic
1076705169 10:132297414-132297436 GCGTGGCCCCTGGTGGGGCTGGG - Intronic
1076903511 10:133351287-133351309 ATGCAGCCCCAGGTGGGCCTCGG + Intronic
1076927766 10:133501812-133501834 ATGTTGCCACTACTGGGGATGGG + Intergenic
1078423118 11:11228571-11228593 ATCGAGCCACTGGAGGGGCAGGG + Intergenic
1078706232 11:13746800-13746822 ATGAAGCCACAGGCAGGGCTGGG + Intergenic
1078918499 11:15804059-15804081 ATGTTGACACTGGTGTGTCTTGG + Intergenic
1079539648 11:21557499-21557521 TTGTAGCCACTGGTGGTGGATGG + Intronic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1080489973 11:32751638-32751660 ATGTGGCCACTGCAGGGGCTGGG + Intronic
1081982518 11:47277149-47277171 AGGCATCCACTGGTGGGTCTTGG - Intronic
1083896844 11:65624355-65624377 ACGTGGCCACTGGTGAGGCTGGG + Exonic
1083931945 11:65850937-65850959 AGGAAGCCACTGGTGGGGCCTGG + Intronic
1083992507 11:66255482-66255504 ATATTGCCACTGGTTGGGCTGGG - Intergenic
1084570816 11:69958798-69958820 ATGTCGGGACTGGTGGGGGTGGG + Intergenic
1085747223 11:79125647-79125669 ATGTTGCCACTACTGGGGATGGG - Intronic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1088192037 11:107237096-107237118 ATGTTGCCACTACTGGGGATGGG + Intergenic
1088264791 11:107978952-107978974 ATGTTGCCACTGCTGGGGATGGG - Intergenic
1088407958 11:109501267-109501289 ATGTTGCCACTACTGGGGATGGG + Intergenic
1089672776 11:120067987-120068009 ATGGAGGCACTGGTGGGGTTGGG - Intergenic
1089848769 11:121479517-121479539 ATTTAGCGACTGGTGTGGCTTGG + Intronic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1093032251 12:14298805-14298827 ATGTTGCCACTACTGGGGATGGG + Intergenic
1093049998 12:14493552-14493574 ATGTTGCCACTACTGGGGATGGG + Intronic
1093582856 12:20804175-20804197 GGGTAGCCACTGGTGGGGAGGGG + Intergenic
1093619877 12:21276684-21276706 ATGTGGCCACTGCTGGGGGATGG - Intronic
1093964205 12:25308366-25308388 ATGTTGCCACTGCTGGGTATCGG - Intergenic
1094102189 12:26776670-26776692 ATGTTGCCACTACTGGGGATGGG - Intronic
1094655937 12:32419508-32419530 ACGCAGCCACTGCTGGGGATGGG + Intronic
1095163203 12:38941034-38941056 ATGCAGCCACTGCCAGGGCTTGG - Intergenic
1097076508 12:56398897-56398919 ATGTTGCCACTACTGGGGATGGG - Intergenic
1097199106 12:57263283-57263305 CTGTAGCCTATGGTGGTGCTGGG - Intronic
1097843731 12:64345377-64345399 ATGTTGCCATTACTGGGGCTAGG + Intronic
1098565807 12:71934235-71934257 GTCTCGCCACTGGTGGGGGTTGG - Intergenic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1098667492 12:73181514-73181536 ATGTGGCTACTGGTGGGGGATGG + Intergenic
1098805105 12:75013478-75013500 ATGTTGCCACTACTGGGGATGGG - Intergenic
1099577744 12:84402848-84402870 ATGTTGCCACTACTGGGGATGGG - Intergenic
1100241529 12:92714288-92714310 ATGTTGCCACTACTGGGGATGGG + Intergenic
1100243180 12:92730117-92730139 ATGTATTCACTGGTGGTCCTGGG - Intronic
1100269783 12:93013906-93013928 ATGTAGCTACGGGCTGGGCTTGG + Intergenic
1101535038 12:105608705-105608727 ATGTTGCCACTACTGGGGATGGG + Intergenic
1102558838 12:113747748-113747770 AATTAGCCACTGGAGGAGCTGGG - Intergenic
1104033965 12:125085666-125085688 ATGTAGCCACTGGGGCAGCTGGG + Intronic
1104052012 12:125201621-125201643 AGCTAGCCAGTGGTGGAGCTGGG - Intronic
1104717932 12:131028957-131028979 ATCCAGCCATGGGTGGGGCTCGG + Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107286782 13:38802373-38802395 ATGTTGCCACTGCTGCTGCTGGG - Intronic
1107490122 13:40873758-40873780 ATGTTGCCACTACTGGGGATGGG - Intergenic
1107983923 13:45758562-45758584 ATGTTGCCACTACTGGGGATGGG + Intergenic
1109592596 13:64505814-64505836 ATGTAGCCACTAGCTGGGCAAGG + Intergenic
1110730336 13:78873357-78873379 GTGTTTCCACTGGAGGGGCTGGG + Intergenic
1111420608 13:88005650-88005672 ATCTAGCCACTGGTGGAGCTGGG - Intergenic
1112912047 13:104498276-104498298 ATGTTGTTAGTGGTGGGGCTTGG - Intergenic
1116158736 14:41239267-41239289 ATGTCGCCACTACTGGGGATGGG + Intergenic
1116414731 14:44666717-44666739 ATGTTGCCACTACTGGGGATGGG - Intergenic
1117633768 14:57721783-57721805 ATGTTGCCACTACTGGGGATGGG - Intronic
1117870647 14:60197398-60197420 ATGTAGCCGCTGCTGAGGATTGG - Intergenic
1118411018 14:65478243-65478265 AGGTATCCACTGGGGGGCCTTGG - Intronic
1118881127 14:69826615-69826637 ATGTTGCCACTACTGGGGATGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120950147 14:90033368-90033390 TTGTAGCCACTGGTTAGTCTTGG + Intronic
1120973307 14:90227858-90227880 ATGTTGCCACTACTGGGGATGGG - Intergenic
1122154592 14:99742542-99742564 ATCTGGCAACTGCTGGGGCTGGG + Intronic
1126110576 15:45172493-45172515 ATCTATCCCCTGGTGGGGGTGGG + Intronic
1126938024 15:53733436-53733458 ATGTAGCCACAGGAAGAGCTGGG - Intronic
1127419812 15:58794083-58794105 ATGTTGCCAGTGGTGGGGCCAGG + Intronic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128354074 15:66912171-66912193 ATGTAGGAAGTGGTGGAGCTGGG + Intergenic
1128535672 15:68488400-68488422 GTGTAGCTACTGGGGGGGCTTGG - Intergenic
1129776427 15:78239696-78239718 ATCTTGCAACTGGTGGGGCACGG - Intronic
1130686047 15:86038817-86038839 AAGAAGTCACTGGTGTGGCTGGG - Intergenic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1132831402 16:1930036-1930058 CTGTGGCCCCTGGTGGGGGTGGG - Intergenic
1132931076 16:2459568-2459590 AGGTGGCCCCTGGTGGGGCAGGG - Intergenic
1140282339 16:73566170-73566192 ATGAAGGCACTGGTGGGACCAGG - Intergenic
1140629344 16:76832961-76832983 CTGCAGCCACTGGGGTGGCTTGG + Intergenic
1140721268 16:77774563-77774585 ACATAGCCACTGGTGAAGCTGGG - Intergenic
1141752779 16:85970295-85970317 ATGTTGCCTCTGGTGGGGCATGG + Intergenic
1142000298 16:87660481-87660503 CTGTGGCCTCTGGTGGGGGTGGG - Intronic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1142919128 17:3169293-3169315 ATGTAGCCACTGCTGGGGGATGG - Intergenic
1144382585 17:14717440-14717462 AGGTGGCTACTGTTGGGGCTTGG + Intergenic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1146237847 17:31185026-31185048 ATGTTGCCACTACTGGGGATGGG - Intronic
1146836142 17:36112512-36112534 ATGTTGCCACTACTGGGGATTGG - Intergenic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1147778615 17:42922819-42922841 ATGTAGCCTCTGCTGGCTCTGGG - Intergenic
1147934894 17:44005715-44005737 ATGAAGCCGCTGGTGGTCCTGGG + Exonic
1148633645 17:49131040-49131062 ATGTGGCCAGTAATGGGGCTAGG - Intergenic
1151037968 17:70822812-70822834 ATGTTGCCACTACTGGGGATGGG + Intergenic
1151374972 17:73681960-73681982 ATGTAGCTGGTGGTGAGGCTGGG + Intergenic
1152635911 17:81430431-81430453 AAGTGGCCGCTGGTGGGGCGTGG - Intronic
1152666587 17:81573815-81573837 ATGTAGCCTTTGATGGGGCGGGG - Intronic
1153218062 18:2838202-2838224 ATGTTGCCACTACTGGGGATGGG + Intergenic
1153227196 18:2907932-2907954 ATGCAGACACTGGCAGGGCTGGG + Intronic
1154033304 18:10773142-10773164 GTCTAGACACTGGTGGGGCATGG - Intronic
1155573496 18:27220610-27220632 ATGTTGCCACTACTGGGGATGGG - Intergenic
1156312150 18:35934590-35934612 AGGTATCCACTGGGGGGTCTTGG + Intergenic
1156990640 18:43403302-43403324 ATGTTGCCACTACTGGGGATGGG + Intergenic
1157313646 18:46570988-46571010 GTGTAGTCAGTGATGGGGCTGGG - Intronic
1157341057 18:46778980-46779002 ATGTTGCCACTACTGGGGGTGGG - Intergenic
1159464431 18:68762893-68762915 AGGCATCCACTGGAGGGGCTTGG + Intronic
1160479038 18:79221257-79221279 ATGAAGCCTCTGGTGGGGCTGGG - Intronic
1160846503 19:1168427-1168449 ATGTTTTCACTGGTGGGGCAGGG - Intronic
1161250991 19:3280204-3280226 CAGTAGCCACTGGTGGGGACTGG - Intronic
1161614887 19:5264604-5264626 AGGAAGCCACTGAGGGGGCTGGG - Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161798706 19:6403180-6403202 TAGAAGCCACTGGTGGAGCTGGG - Intergenic
1163716727 19:18877259-18877281 AGCCAGACACTGGTGGGGCTGGG + Intronic
1164097469 19:22024261-22024283 ATGTTGCCACTACTGGGGATGGG + Intergenic
1164117656 19:22237710-22237732 ATGTTGCCACTACTGGGGATGGG + Intergenic
1165393312 19:35550489-35550511 AAGCAGATACTGGTGGGGCTGGG + Exonic
1167023616 19:46897814-46897836 ATGTAGCCACTGGTGAGGGAAGG - Intergenic
1168498412 19:56873420-56873442 TTTTACCCACTGGTGTGGCTTGG + Intergenic
925499746 2:4489511-4489533 ATGTTGCCACTACTGGGGATGGG + Intergenic
925556654 2:5138176-5138198 ATGTAAGCACAGGTGGTGCTTGG - Intergenic
925772667 2:7298459-7298481 CTGTAGCCAATGGTTTGGCTGGG - Intergenic
926406567 2:12559036-12559058 GTTTGGCCACTGGTGGGGCTCGG - Intergenic
926810743 2:16753276-16753298 ATGTTGCCACTACTGGGGATGGG + Intergenic
928715662 2:34056750-34056772 ATGCAGCCACTGCTGGGGGATGG + Intergenic
930290783 2:49490787-49490809 ATGGAGCCACTGGTGTGGCCAGG + Intergenic
930909807 2:56618234-56618256 ATGTTGCCACTACTGGGGATGGG - Intergenic
935177532 2:100663000-100663022 AGGCAGCCACTGGTGGCTCTAGG + Intergenic
935183703 2:100713205-100713227 ATGTTGCCACTACTGGGGATAGG - Intergenic
935564232 2:104589693-104589715 CTGTAGCCAGTGGTTTGGCTGGG - Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937120553 2:119437516-119437538 ATGTGGCCTCTGGTGGGGCTGGG + Exonic
937452365 2:122012219-122012241 ATGTGGCCACTGGTGGAGCTGGG + Intergenic
937785536 2:125890262-125890284 ATGTTGCCACTACTGGGGATGGG + Intergenic
939021061 2:136958980-136959002 ATGGAGGTGCTGGTGGGGCTAGG + Intronic
940429893 2:153576607-153576629 ATGCAGCCCCTGCTGGGGGTTGG + Intergenic
941164133 2:162067090-162067112 ATTTAGCCACTGTTGGACCTTGG + Intronic
941667647 2:168258578-168258600 ATGTTGCCACTACTGGGGATGGG - Intergenic
943182175 2:184559187-184559209 CTGTAGCCAGTGGTTTGGCTGGG + Intergenic
943384365 2:187183455-187183477 ATGTTGCCACTACTGGGGATGGG + Intergenic
943724152 2:191235821-191235843 ATGTGGCAACTGGTGGGGCGCGG + Intergenic
945641822 2:212441221-212441243 ATGTTGCCACTACTGGGGATGGG - Intronic
946321498 2:218957313-218957335 ATGTAGCCACTGTTGCTGATGGG + Intergenic
947009285 2:225547666-225547688 ATGTGGCCACTGCTGGGGGATGG + Intronic
947765783 2:232636294-232636316 AGGGAGCAAGTGGTGGGGCTGGG - Intronic
948147698 2:235720416-235720438 AAGTAACCACAGGTGAGGCTGGG - Intronic
948153880 2:235765404-235765426 ATGTTCCCACTGGAGGGGCCGGG - Intronic
948253976 2:236552740-236552762 ATGTAGCCACTGAAGGGACAAGG + Intergenic
1169463693 20:5819150-5819172 AAGTAGACACTGGCGGGGCACGG - Intronic
1171018116 20:21560243-21560265 CTGCAGCCCCTGGTGGGGCTGGG + Intergenic
1171296348 20:24020497-24020519 ATGTTGCCACTACTGGGGATAGG - Intergenic
1172409962 20:34713750-34713772 AAGTAGCCACTGGAGGGGAAAGG + Intronic
1172619923 20:36312073-36312095 ATGGGGCCTCTGGCGGGGCTGGG - Intronic
1173507173 20:43597029-43597051 ATGTGGCTACTGGCTGGGCTCGG - Intronic
1173531412 20:43772522-43772544 TGGTTGCCACTGGTGGGGATGGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175520055 20:59596882-59596904 ATGAAGCCACTGGCCAGGCTGGG - Intronic
1176021893 20:62966410-62966432 GTGGAGCCACGGGAGGGGCTGGG - Intronic
1176997807 21:15577626-15577648 ATGTTGCCACTACTGGGGATGGG - Intergenic
1177002982 21:15636140-15636162 ATGTTGCCACTACTGGGGATGGG + Intergenic
1177363376 21:20103252-20103274 ATGTTGCCACTACTGGGGATGGG - Intergenic
1178012289 21:28302314-28302336 ATGTTGCCACTACTGGGGATGGG - Intergenic
1178478966 21:32962580-32962602 CTGTTGCTACTGGTGGGGGTGGG + Intergenic
1180119309 21:45736284-45736306 TTGGTGCCAGTGGTGGGGCTGGG + Intronic
1180998363 22:19976600-19976622 ATGAAGCCAGGGGTGGGGCAGGG + Intronic
1181048998 22:20229930-20229952 ATGCAGCCACTGGCAGAGCTGGG - Intergenic
1182965723 22:34519402-34519424 ATGTTGCCACTACTGGGGATGGG + Intergenic
1183267035 22:36834283-36834305 ATGTACCCACTGCTGTGGATTGG - Intergenic
1183869979 22:40734050-40734072 GTGTAGCCAATGGTGTGGCAGGG - Intergenic
1184403269 22:44286136-44286158 ATGTAGGCAAAGGTGGGGCAGGG - Intronic
1184603921 22:45560986-45561008 ATGTTGCCACTACTGGGGATGGG + Intronic
1184702632 22:46186801-46186823 AGGTATCCACTGTGGGGGCTTGG - Intronic
1184741619 22:46431911-46431933 ATGTCACCCCTAGTGGGGCTTGG - Intronic
1185388630 22:50547680-50547702 ATGAAGCCAGGGCTGGGGCTAGG - Intergenic
1185419240 22:50726257-50726279 CTGTGGCCAGTTGTGGGGCTCGG - Intergenic
949418009 3:3833786-3833808 ATGTTGCCACTACTGGGGATGGG + Intronic
949445266 3:4128411-4128433 ATGTTGCCACTACTGGGGATAGG - Intronic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
951122248 3:18942983-18943005 ATGTTGCCACTAATGGGGATGGG - Intergenic
951291038 3:20872795-20872817 ATGTTGCCACTCTTGGGGTTGGG - Intergenic
951384195 3:22025162-22025184 ATGTTGCCACTACTGGGGATGGG - Intronic
952033462 3:29172516-29172538 AAGTAACCACTGGCGGGGCGCGG + Intergenic
953168684 3:40488046-40488068 AGGGAGGCCCTGGTGGGGCTAGG - Exonic
954073204 3:48158170-48158192 CGGTAGCCAGTGGTGGGTCTGGG + Exonic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
955035235 3:55261491-55261513 ATGTTGCCACTACTGGGGATGGG - Intergenic
955138664 3:56246877-56246899 ATCTAACAACTGGTGTGGCTCGG + Intronic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
955274504 3:57534219-57534241 ATGCAGCCACTGCTGGGATTGGG + Intronic
955500033 3:59574400-59574422 AGCTTGCCACTGGTGGAGCTGGG - Intergenic
955686977 3:61558953-61558975 TTGTAGGAACTGGTGGGGCCTGG + Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956509292 3:69977760-69977782 ATGTTGCCACTACTGGGGATGGG - Intergenic
957247882 3:77735933-77735955 ATGTTGCCACTACTGGGGTTGGG + Intergenic
958499497 3:94887546-94887568 ATGTTGCCACTACTGGGGATAGG - Intergenic
959227118 3:103599895-103599917 ATGTTGCCACTACTGGGGATAGG + Intergenic
959377738 3:105605772-105605794 ATGTTGCCACTACTGGGGATGGG + Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
963629960 3:147720624-147720646 ATGTTGCCACTGCTGGGGATGGG - Intergenic
965118429 3:164520833-164520855 ATGTTGCCACTGTCGGGGGTGGG + Intergenic
965996140 3:174885037-174885059 ATGTTGCCTCTGCTGGGGATGGG + Intronic
966044671 3:175533512-175533534 ATGTTGCCACTACTGGGGATGGG + Intronic
966983640 3:185160321-185160343 ATCTGGCCCCTGGTGGGCCTTGG + Intergenic
968906513 4:3455022-3455044 ATGTTGCCACTACTGGGGATGGG - Intergenic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971126509 4:23760864-23760886 CTGTAGCCAATGGTTTGGCTGGG + Intronic
971236956 4:24850837-24850859 ATCTGGCCTCTGGTGGGGGTTGG + Intronic
972176712 4:36417238-36417260 ATATATCCGCTGATGGGGCTGGG + Intergenic
974780030 4:66543139-66543161 ATGTTGACACTGCTGGGGCATGG - Intergenic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
977534654 4:98242935-98242957 AGGCATCCACTGGGGGGGCTTGG + Intergenic
977898788 4:102395145-102395167 CTGTAGCCAATGGTTTGGCTGGG + Intronic
977930331 4:102743262-102743284 CTGTAGCCAATGGTTTGGCTGGG - Intronic
978899429 4:113929444-113929466 ATGTTGCCACTACTGGGGATGGG + Intronic
978966499 4:114748334-114748356 ATGTTGCCACTACTGGGGATGGG - Intergenic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
980601817 4:135036879-135036901 ATGTTGCCACTACTGGGGTTAGG - Intergenic
980697804 4:136382289-136382311 CTGTAGCCAATGGTTTGGCTGGG + Intergenic
981307468 4:143262220-143262242 AAGGAGACACTGGTGGGGGTGGG - Intergenic
981558722 4:146023869-146023891 ACATGGCCACTGCTGGGGCTGGG + Intergenic
981834508 4:149039856-149039878 ATGTTGCCACTACTGGGGATGGG - Intergenic
982526858 4:156489813-156489835 ATGTAGCCATTACTGGGGATGGG - Intergenic
982776965 4:159451996-159452018 ATATAGCCATTGGTGTGCCTAGG - Intergenic
983785300 4:171722136-171722158 ATGTTGCCACTACTGGGGATGGG + Intergenic
984826655 4:183931131-183931153 ATGGAGCTACTGGTTGGGCACGG + Intronic
986086772 5:4460114-4460136 ATGTTGCCACTACTGGGGATGGG - Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
986938656 5:12921335-12921357 ATGTTGCCACTACTGGGGATGGG + Intergenic
987468116 5:18296431-18296453 CTGTAGCCAATGGTTTGGCTGGG - Intergenic
987578697 5:19760933-19760955 ATGTCGCCACTACTGGGGATGGG + Intronic
987657455 5:20824237-20824259 ATGTTGCCACTACTGGGGATGGG + Intergenic
988188438 5:27898645-27898667 ATGTTGCCACTACTGGGGATGGG - Intergenic
988233614 5:28509684-28509706 ATGTTGCCACTTCTGGGGATGGG + Intergenic
988561777 5:32288281-32288303 ATGTTGCCACTACTGGGGATGGG - Intronic
988766089 5:34379709-34379731 ATGTTGCCACTACTGGGGATGGG - Intergenic
991033192 5:62103312-62103334 ATGTTGCCACTACTGGGGATAGG - Intergenic
991945783 5:71897539-71897561 ATGTTGCCACTATTGGGGATGGG - Intergenic
992352915 5:75949331-75949353 AGGGACCCATTGGTGGGGCTTGG + Intergenic
993791440 5:92216315-92216337 ATGGTGCCACTAGTGGGGATAGG - Intergenic
994291293 5:98031394-98031416 CTGTAGCCAATGGTTTGGCTGGG - Intergenic
994515877 5:100772527-100772549 ATGCAGAAACTGGTGGAGCTAGG - Intergenic
995279418 5:110316504-110316526 ATGTTGCCACTACTGGGGATGGG + Intronic
995776649 5:115730276-115730298 ATGTTGCCACTACTGGGGATGGG + Intergenic
996757206 5:126947579-126947601 ATGTACCCTCTGGTGGGGGATGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1000730430 5:164828356-164828378 ATGTTGCCACTACTGGGGATGGG - Intergenic
1001191157 5:169632560-169632582 ATGGAGACATTGATGGGGCTGGG + Intergenic
1001574309 5:172751924-172751946 CTGTAGGCACTGGTAGGGCAGGG - Intergenic
1001579484 5:172789170-172789192 ATGGTGGCACTGGTGGGGGTTGG + Intergenic
1004299697 6:14446064-14446086 ATGTTGGCACTATTGGGGCTAGG - Intergenic
1005037539 6:21570406-21570428 ATGTGGCCACTGCTGGGGGATGG + Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005718969 6:28582093-28582115 ATGTAGCTTCTGGTAGGACTTGG - Intronic
1006439218 6:34042855-34042877 GTGTGGCCACTGGTGTGGCCAGG - Intronic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1007163400 6:39810953-39810975 TTGTGGCCACTGGTGGGCTTTGG + Intronic
1007820615 6:44558135-44558157 ATGTTGCCAGTGTTGGGGCAGGG - Intergenic
1008399933 6:51052878-51052900 ATGTTGCCACTACTGGGGATGGG - Intergenic
1009266044 6:61556043-61556065 CTGGGGCCACTGGTGGGCCTAGG + Intergenic
1009390455 6:63137658-63137680 ATGTTGCCACTACTGGGGATGGG + Intergenic
1010552085 6:77236118-77236140 ATGTTGCCACTACTGGGGATGGG - Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012203551 6:96435414-96435436 CTGTAGCCCCTGTTGGGGATGGG + Intergenic
1012344234 6:98167728-98167750 ATGTTGCCACTACTGGGGATGGG - Intergenic
1014416662 6:121192783-121192805 ATGTTGCCACTACTGGGGATGGG - Intronic
1014534553 6:122599240-122599262 ATGTTGCCACTACTGGGGATGGG + Intronic
1015475390 6:133654720-133654742 ATGTTGCCACTACTGGGGTTGGG - Intergenic
1016147643 6:140695317-140695339 ATGTTGCCACTACTGGGGATGGG + Intergenic
1016576599 6:145575199-145575221 ATGTTGCCACTACTGGGGATGGG + Intronic
1018569617 6:165195468-165195490 ATGTTGCCACTACTGGGGATGGG - Intergenic
1019409167 7:899160-899182 ATGTGGCCAGTGGTGGCCCTGGG + Exonic
1019436766 7:1026160-1026182 TTGTATCCACAGGTAGGGCTGGG + Intronic
1021391795 7:20102255-20102277 ATTTAGCAAATGGTTGGGCTAGG - Intergenic
1023377590 7:39574178-39574200 ATGTAGCCAATGGTGGCAATGGG - Intronic
1023716126 7:43046249-43046271 ATGCAGCCACTGCTGGGGGATGG - Intergenic
1023754528 7:43403792-43403814 AGGTTGCCACTGGTGGGGAGGGG + Intronic
1024040228 7:45547285-45547307 ATGTAGCCACTACTGGGGATGGG + Intergenic
1024048773 7:45603561-45603583 ATGTTGCCACTGGGGAAGCTGGG - Intronic
1025761806 7:64402887-64402909 ATGTTGCCACTCCTGGGGATGGG - Intergenic
1026505479 7:70979255-70979277 ATGGAGCCAAAGGTGGGGGTGGG + Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028043522 7:86088862-86088884 ATGTTGCTACTACTGGGGCTGGG - Intergenic
1028141393 7:87279378-87279400 ATGTTGCCACTGCTGGGGATGGG - Intergenic
1028201359 7:87966135-87966157 ATCAAGCCAATAGTGGGGCTGGG + Intronic
1029139079 7:98397133-98397155 ATGTAGTCTAAGGTGGGGCTGGG + Intronic
1030312060 7:108078946-108078968 ATGTGGTCCCTAGTGGGGCTTGG + Intronic
1030368202 7:108670352-108670374 ATGTTGCCACTACTGGGGGTGGG - Intergenic
1032403427 7:131639310-131639332 ATGCAGACAGGGGTGGGGCTAGG - Intergenic
1033075858 7:138250104-138250126 ATGTTGCCACTACTGGGGATAGG - Intergenic
1033680449 7:143589312-143589334 ATGTAACCACTGGTGAATCTAGG - Intergenic
1033704445 7:143872500-143872522 ATGTAACCACTGGTGAATCTAGG + Intronic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1035280175 7:157773465-157773487 ATGAAGACACGGGTGGTGCTGGG - Intronic
1035549254 8:507609-507631 ATGTGGCTTCTGGTGGGGCACGG - Intronic
1037549798 8:19959115-19959137 ATGGAACCACTGGTGTGGCTTGG - Intronic
1038005119 8:23423541-23423563 AACTAGCCAGTGGTGGGGCTGGG - Intronic
1039701906 8:39970679-39970701 ATGTAGCCACTGGCCAGGCGTGG - Intronic
1039914933 8:41852727-41852749 ATGACGCCACTGGTGGGTGTTGG + Intronic
1041985846 8:63921880-63921902 ATGTAGCCACTACTGGGGATGGG - Intergenic
1042001406 8:64126575-64126597 ATGTTGCCACTACTGGGGATAGG + Intergenic
1043257668 8:78156781-78156803 ATGTTGCCACTACTGGGGATGGG - Intergenic
1044286342 8:90415300-90415322 ATGTTGCCACTACTGGGGGTGGG + Intergenic
1045817377 8:106292558-106292580 AGGTATCCATTGGTGGGTCTTGG + Intronic
1046417997 8:113940426-113940448 ATGTTGCCACTAGTGGGGATGGG + Intergenic
1048084232 8:131159754-131159776 ATGTCGCCACTACTGGGGATGGG + Intergenic
1048896889 8:139000396-139000418 ATGTGTGCACTTGTGGGGCTGGG + Intergenic
1049500143 8:142958572-142958594 ATGTAACCACTGGGGGAACTGGG - Intergenic
1049513725 8:143042830-143042852 AAGCAGCCAGTGGTGGGGCCTGG + Intronic
1050447403 9:5739728-5739750 ATGTTGCCACTATTGGGGATGGG + Intronic
1050482304 9:6100000-6100022 ATGTTGCCACTACTGGGGATGGG - Intergenic
1051966065 9:22831629-22831651 ATGTTGCCACTACTGGGGATAGG - Intergenic
1055300556 9:74877892-74877914 ATGTAGCCACTGGCTGTGGTAGG - Intronic
1056703414 9:88931162-88931184 AAGTGGGCCCTGGTGGGGCTAGG + Intergenic
1057316229 9:93970527-93970549 ATGTTGCCACTACTGGGGATGGG - Intergenic
1060370933 9:123070292-123070314 ATGTAGCCACTTGTGGGCCATGG - Intronic
1060905857 9:127304825-127304847 ATAAAGCCACTGGCCGGGCTTGG - Intronic
1061855409 9:133439392-133439414 ATGTAGACACTGGTCAGGTTGGG - Exonic
1188917991 X:35935425-35935447 ATGCTGCCACTGCTGGGGGTTGG + Intronic
1190404527 X:50073408-50073430 AACTAGCAAGTGGTGGGGCTTGG - Intronic
1190917497 X:54821411-54821433 ATGGAGCCAGTGTTGGGCCTTGG + Intergenic
1191687845 X:63910768-63910790 ATGTAGCCAATGGTAGGGCTGGG + Intergenic
1193297453 X:79850089-79850111 ATGTTGCCACTACTGGGGATGGG - Intergenic
1193869652 X:86780958-86780980 ATGTTGCCACTACTGGGGATGGG + Intronic
1194342968 X:92728498-92728520 ATGTTGCCACTACTGGGGATAGG - Intergenic
1195782716 X:108482475-108482497 ATGTTGCCACTACTGGGGATGGG + Intronic
1195810007 X:108818434-108818456 ATGTTGCCACTACTGGGGATGGG + Intergenic
1196093823 X:111776862-111776884 ATGATGGCAGTGGTGGGGCTCGG - Exonic
1196275469 X:113761504-113761526 ATGTTGCCACTACTGGGGATGGG - Intergenic
1196619468 X:117806279-117806301 ATGCAGCCACAGATGGGGGTTGG - Intergenic
1196684533 X:118499193-118499215 ATGTAGCTACTGGTGCCGCAGGG + Intronic
1197097127 X:122610232-122610254 ATGTTGCCACTACTGGGGATGGG - Intergenic
1197404746 X:126036579-126036601 ATGTTGCCACTACTGGGGATGGG - Intergenic
1198721881 X:139631114-139631136 ATATAGCCACAGGAGGGGATGGG + Intronic
1199036293 X:143054140-143054162 ATGCAGCCACTGGTGGGTGTTGG + Intergenic
1199627428 X:149753203-149753225 ATGTTGCCACTACTGGGGATGGG + Intergenic
1199794481 X:151181078-151181100 ATGTGGCCAGTGGTGGGTTTAGG - Exonic
1200340642 X:155391695-155391717 ATGTTGCCACTACTGGGGATGGG + Intergenic
1200651329 Y:5845164-5845186 ATGTTGCCACTACTGGGGATAGG - Intergenic
1201400310 Y:13597600-13597622 ATGTTGCCACCACTGGGGCTGGG + Intergenic