ID: 1127834045

View in Genome Browser
Species Human (GRCh38)
Location 15:62775751-62775773
Sequence GCCGCCCTGAGCCACCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127834045_1127834047 -7 Left 1127834045 15:62775751-62775773 CCAACAAGGTGGCTCAGGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1127834047 15:62775767-62775789 GGGCGGCCGTAGCCACGGCATGG 0: 1
1: 0
2: 0
3: 33
4: 133
1127834045_1127834048 -6 Left 1127834045 15:62775751-62775773 CCAACAAGGTGGCTCAGGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1127834048 15:62775768-62775790 GGCGGCCGTAGCCACGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1127834045_1127834051 10 Left 1127834045 15:62775751-62775773 CCAACAAGGTGGCTCAGGGCGGC 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1127834051 15:62775784-62775806 GCATGGGTAGACCCAGTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127834045 Original CRISPR GCCGCCCTGAGCCACCTTGT TGG (reversed) Intronic
900313596 1:2046543-2046565 GCCACACAGAGCCACCTTGGCGG + Intergenic
900486262 1:2924217-2924239 GCCGCCCGAAGCCAGCTGGTGGG - Intergenic
907480616 1:54743379-54743401 CCTGCCCTGAGCCATCATGTGGG + Intergenic
917974943 1:180232530-180232552 GCCTCCCTGGGCCACCCTGGGGG - Intronic
1062833543 10:622133-622155 GCTGCCCTGAGGCACCTGCTGGG + Intronic
1063548081 10:7001389-7001411 GGAGCCCTGAGCCACCGTGGAGG + Intergenic
1072124015 10:92429701-92429723 GCAGGCCTGAGCCACCGTGCTGG + Intergenic
1075426820 10:122348420-122348442 GCCACCCAGAGACACCTTCTTGG + Intergenic
1076156007 10:128206530-128206552 GCTGTCCTGAGGCACCCTGTGGG + Intergenic
1078951012 11:16134322-16134344 GGGGCCCTGGGCCACGTTGTAGG + Intronic
1080784643 11:35463600-35463622 GCCTCCTTGGGCCACCGTGTAGG - Intronic
1083356886 11:62073128-62073150 GCTGCACTGAGTCAGCTTGTGGG - Intergenic
1083886734 11:65576714-65576736 GCCACCCTGAACCACCTTTCTGG - Intronic
1086330905 11:85753219-85753241 GCTGCCCTGACCCACCTTTAAGG - Intronic
1089525173 11:119092506-119092528 GCCTTCCTGAGGCACCTGGTAGG + Exonic
1093450432 12:19307194-19307216 ACTGGCCTGAGCCACCATGTGGG - Intronic
1096241796 12:49963633-49963655 GTCACCCTGGGCCACCTTGTCGG + Exonic
1096691161 12:53322619-53322641 ACAGGCCTGAGCCACCTTGCCGG + Intronic
1098301014 12:69054217-69054239 ACCGACCAGAGCAACCTTGTAGG - Intergenic
1098305100 12:69095112-69095134 TCCTCCCTGAACCACCTTGTTGG - Intergenic
1098317332 12:69206622-69206644 AGAGTCCTGAGCCACCTTGTAGG + Intergenic
1100282152 12:93128214-93128236 CCCGCCCTGAGGCACCCTATAGG + Intergenic
1102233395 12:111278945-111278967 GGAGCCCTGAGCTACCTTGCTGG - Intronic
1102955118 12:117054144-117054166 GCAGCTCTGAGCCACCTGGGAGG - Intronic
1103234827 12:119362820-119362842 ATAGGCCTGAGCCACCTTGTGGG - Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104714899 12:131010184-131010206 GCTGCCATGTGCCACCTTGTTGG + Intronic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1118975828 14:70675893-70675915 GCCGCCCTGAGCCATTGTGCTGG + Intergenic
1121312499 14:92942838-92942860 GCCTGCCTGAGCCAACTTGGAGG + Intronic
1122993374 14:105249240-105249262 GCCGCCGCTACCCACCTTGTGGG - Exonic
1123764689 15:23466482-23466504 GCAGGCCTGAGCCACCATGCAGG + Intergenic
1126979909 15:54228843-54228865 GTCTCCCTGAGCCACCTAGATGG + Intronic
1127834045 15:62775751-62775773 GCCGCCCTGAGCCACCTTGTTGG - Intronic
1128783791 15:70380042-70380064 GCCATCCTGGGCCTCCTTGTTGG + Intergenic
1129247980 15:74291595-74291617 CCCGCCCTGAGCCTTCTTGCTGG - Intronic
1129447814 15:75631166-75631188 GCCACCTGGAGACACCTTGTAGG + Intergenic
1131513200 15:93060945-93060967 GCTTCCCTGCGCCACCTTCTTGG + Intronic
1136044520 16:27604772-27604794 GCCTACCTCTGCCACCTTGTAGG + Intronic
1139420344 16:66845697-66845719 CCTGCTCTGAGCCACCTTTTGGG + Intronic
1141201455 16:81901451-81901473 GGGTCCCTGAGTCACCTTGTGGG - Intronic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143766149 17:9138852-9138874 GTGACCCTGAGCCACCTTGTGGG - Intronic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1148568148 17:48646166-48646188 GACGCCCTGAGCAGCCTTGGGGG - Intergenic
1158370492 18:56797037-56797059 CCCTCCCTGAGGCACCTTGGCGG + Intronic
1160511228 18:79454608-79454630 GCCGCCCTGAGACACCTGGGAGG - Intronic
1160789868 19:918419-918441 GCCTCCCTGAGCCATCCTGCTGG + Intronic
1163149148 19:15400919-15400941 GCCGCCCAGTACCACCTAGTGGG + Intronic
1163424564 19:17234405-17234427 ACAGGCCTGAGCCACCTTGCAGG + Intronic
1163430912 19:17267037-17267059 GCTGGCCTGAGCCTCCATGTGGG - Intronic
1165767237 19:38359225-38359247 GGGCCCCTGAGCCACCTTCTTGG + Intronic
925005435 2:439808-439830 GTTGAACTGAGCCACCTTGTGGG + Intergenic
927369163 2:22334587-22334609 GCAGGCATGAGCCACCATGTCGG + Intergenic
934710253 2:96509665-96509687 GCCGCCCTCAGCCACCAAGTCGG + Intergenic
936433275 2:112482269-112482291 TCCGCGCTGAGCCGCCTTCTCGG + Exonic
936944707 2:117919891-117919913 GCCTCCCTGGGCCACCTGCTGGG + Exonic
944414197 2:199467192-199467214 GACGCCCAGAGCCCTCTTGTTGG + Intronic
946110593 2:217412048-217412070 GCAGCCCTGTGCTTCCTTGTAGG - Intronic
946245543 2:218385158-218385180 GCTGCTCTGGGCCACCGTGTTGG + Exonic
948560168 2:238847091-238847113 GCCACCCTGAGCCTCCTGCTCGG + Intergenic
1171201310 20:23244652-23244674 GGCGCCCTGGGCCACCTGGAGGG + Intergenic
1171225900 20:23441973-23441995 GCCTCACTGAGCCAGCCTGTGGG - Intronic
1173012946 20:39199130-39199152 GAAGCCTTGAGCCACCATGTAGG - Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1180157491 21:45984595-45984617 GCCTCCCTGACCCACTTTGTGGG + Intronic
1183500314 22:38174948-38174970 CCCGCTCTGAGCCACCCTCTTGG - Intronic
1184598930 22:45531376-45531398 ACAGGCCTGAGCCACCTTGCTGG - Intronic
950260883 3:11542920-11542942 GCAGCCCTGAGCATCTTTGTAGG + Intronic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
953567567 3:44046018-44046040 GCCACCCTGAGCCTCTCTGTGGG + Intergenic
953697506 3:45171439-45171461 GCTGCCCTGAGCTCCCTTATGGG - Intergenic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
965971481 3:174561474-174561496 ACCGCCATGAGCCACCATGCCGG + Intronic
982754559 4:159202899-159202921 GCCTCCATGAGCAACCTTTTTGG + Intronic
984223836 4:177010651-177010673 GAGGCCCTGAGCCAACCTGTGGG - Intergenic
984712566 4:182897955-182897977 GCCGCCCTGTACCTCCTTTTGGG + Intronic
986265425 5:6186223-6186245 GAAGCCCTGAGCCACCTCCTAGG + Intergenic
995039403 5:107571094-107571116 GCCGCCCTGGGCCCCATTCTTGG - Intronic
996811155 5:127517627-127517649 GCCGCCCGTGGCCATCTTGTAGG + Intronic
997611553 5:135218988-135219010 GACGCCCTGAGCAAGCTTGGAGG + Intronic
1001973820 5:175979795-175979817 GCCGCACTCAGCCCTCTTGTGGG - Intronic
1002243612 5:177863984-177864006 GCCGCACTCAGCCCTCTTGTGGG + Intergenic
1006523136 6:34583633-34583655 GCTGCCCCGAGCCACGTTGTGGG - Intergenic
1006755488 6:36411663-36411685 ACAGGCATGAGCCACCTTGTAGG - Intronic
1012370647 6:98502552-98502574 GTCACTCTGAGCCAGCTTGTTGG - Intergenic
1019094032 6:169564458-169564480 GCTGCCCTGTGCCACCGTGATGG - Intronic
1019525362 7:1478209-1478231 CCCGCCCTGAGCCATCTGGGAGG + Intronic
1020632194 7:10652739-10652761 GCCACACTAAGCCACCTGGTGGG - Intergenic
1021443214 7:20703441-20703463 ACCACCCTGAGCCACTGTGTTGG - Intronic
1022005909 7:26265500-26265522 GCAGCCTTGAGCCCCCTCGTTGG + Intergenic
1022105298 7:27192556-27192578 GCCGCCCTCAGCCAGCTCCTGGG + Intergenic
1032328744 7:130957321-130957343 GCCACCCTGAGCCCTCTTGCTGG - Intergenic
1033390605 7:140924453-140924475 GATGCCCTCAGCCACCTTCTCGG - Intronic
1035751995 8:2002670-2002692 GCCGTCGAGAGCCACCATGTCGG - Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1038196468 8:25372811-25372833 GGCGCCCTGAGGCACCTTTGTGG + Intronic
1040457869 8:47617875-47617897 GCTTCTCTGAGCCACATTGTTGG + Intronic
1040599582 8:48870477-48870499 GACGCCCTTAGTCACCTTATCGG + Intergenic
1042086381 8:65113844-65113866 GCCTCCCTGAGCCAGATTTTTGG + Intergenic
1045357424 8:101402163-101402185 GCTGGCCTGAGCAACCTTCTTGG - Intergenic
1047864230 8:129004092-129004114 ACAGGCGTGAGCCACCTTGTGGG + Intergenic
1048992505 8:139769377-139769399 CCCACCCTGAGCCACCTAGGAGG - Intronic
1058200921 9:102039390-102039412 GCTTCCCTGAGCCACATTGGAGG + Intergenic
1061231772 9:129319719-129319741 CTGGCCCTGAGCCACCCTGTGGG + Intergenic
1061873135 9:133531242-133531264 GCAGCCCTGAGGCCCCTTCTGGG - Intergenic
1186026968 X:5323885-5323907 GCAGCCCTGAGCCCCCAGGTAGG - Intergenic
1186165848 X:6825222-6825244 GCTGCTCTGAACCATCTTGTGGG - Intergenic
1188716884 X:33469558-33469580 GCTTCCCTGAGCCACATTGGAGG - Intergenic
1196855065 X:119974737-119974759 GTCGCCCTGAGCCACTGGGTAGG - Intergenic