ID: 1127836274

View in Genome Browser
Species Human (GRCh38)
Location 15:62793621-62793643
Sequence ATGAAGAAACATTCAGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 388}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127836274 Original CRISPR ATGAAGAAACATTCAGAGTA TGG (reversed) Intronic
900439595 1:2647289-2647311 ATGAAGAAACCTTCAGTGACCGG - Intronic
902413597 1:16226295-16226317 AAGAAGAAACATACAGAGATGGG - Intergenic
902613726 1:17612345-17612367 ATGAAGAGACAGTCAGATGAAGG - Intronic
902936361 1:19767661-19767683 ATGAAGAAGCAATGAGAGAAAGG + Intronic
905130691 1:35754626-35754648 ATAATGAAACATTCAAAATAGGG - Intronic
905236473 1:36553580-36553602 ATGAAAAATCAAGCAGAGTAGGG - Intergenic
905440690 1:37995018-37995040 ATGAAGAAACATTTAGGGGCAGG - Intergenic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907643295 1:56214437-56214459 GAGAAGAAACATCCAGAGGAAGG - Intergenic
907857062 1:58313798-58313820 ATGAAGATACAATGAGAGGATGG - Intronic
908253238 1:62281804-62281826 ATGAAGAAACACCCAGAATTGGG - Intronic
908558943 1:65285627-65285649 ATGAAAAAACAATCATAGTGCGG - Intronic
908784679 1:67723233-67723255 ATGAAGAAAAGTGCAGAGGATGG + Intronic
908860308 1:68478721-68478743 GTGTAGAACCAATCAGAGTAAGG + Intronic
910481161 1:87659888-87659910 ATGTACAAACATTCATACTAAGG + Intergenic
915264609 1:154707879-154707901 ATCAAGAAACATTCAGACCAGGG - Exonic
916366568 1:164035557-164035579 ATTAAGGAACAGTCAGAGAAGGG - Intergenic
916559019 1:165916685-165916707 ATGTAAAAACATTCTGAGAAGGG - Intergenic
916702574 1:167313173-167313195 ATCAAGGAAGATACAGAGTAAGG + Intronic
916932405 1:169592318-169592340 ATGGAGAAAGAATAAGAGTAAGG + Intronic
917241711 1:172955905-172955927 AGGAACAAACATTCAGACCATGG - Intergenic
918189602 1:182161405-182161427 AGGAAGAAACATTGAGACAAAGG - Intergenic
918682733 1:187374975-187374997 ATGTAGAATCATGTAGAGTATGG - Intergenic
919230583 1:194768098-194768120 GTGAAGAAACAGTCAGAATCTGG - Intergenic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
920266859 1:204730440-204730462 AGGAAGAAACATCAAGGGTAAGG + Intergenic
920993866 1:210967719-210967741 ATGAAGAAAAATTAAGTGAAAGG - Intronic
923205628 1:231756130-231756152 ATCTAGAAACATTCAGAACATGG - Intronic
923636020 1:235697278-235697300 ATGAAGAAAAATAAAAAGTATGG + Intronic
923862200 1:237902941-237902963 ATCAATAAACATGCAGAATAAGG + Intergenic
924000012 1:239540144-239540166 ATGAGGACACATTCTGAGAAAGG - Intronic
924656844 1:245980197-245980219 ATGAAAAATCATGCACAGTAAGG - Intronic
1062799163 10:367115-367137 AGGAAGAAAGATTCACATTAAGG + Intronic
1062899077 10:1128204-1128226 ATTAAGAAACACTCAAAGAATGG - Intronic
1064886342 10:20116601-20116623 ATGAAGTAACATTAGAAGTAAGG + Intronic
1066295486 10:34050600-34050622 ATCAAGAAACAGTCAGAGGCTGG + Intergenic
1066363308 10:34751901-34751923 ATAAAGAAACATTTAGGTTAAGG - Intronic
1067561431 10:47307500-47307522 ATGCAGAAACATCCAGAGAGAGG + Intronic
1067674649 10:48361782-48361804 AAGAAGAAAGATGCAGACTAAGG - Intronic
1068709542 10:60118599-60118621 ACCAACAAACCTTCAGAGTAGGG + Intronic
1068742605 10:60491274-60491296 ATGAAGAAACATATAAAGTGAGG + Intronic
1068965184 10:62904832-62904854 AGGAAGAGACATTCAGAAGAGGG + Intronic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1070271882 10:74964500-74964522 CTGAAGAAACATTTAGGGAATGG - Intronic
1070340288 10:75492074-75492096 ATGTAGATACACTCAGAGAAAGG + Intronic
1070364586 10:75724091-75724113 GGGAAGAAAAATTCAGACTAGGG + Intronic
1071949986 10:90692532-90692554 ATGCAGACACATAAAGAGTAAGG + Intergenic
1072097951 10:92200815-92200837 GTGAAGAAACATTAGGAATAGGG - Intronic
1072880509 10:99222493-99222515 AGGAAGAATAAGTCAGAGTATGG + Intronic
1073119784 10:101114530-101114552 ATGAAGAGACATGCAGGGCAGGG - Intronic
1075044015 10:119131748-119131770 ATGATGAAAAATTCAAACTATGG + Intronic
1075880137 10:125843948-125843970 ATGGGAAAACATTCAGAATAGGG - Intronic
1076454678 10:130581824-130581846 ATGAAGAAAGCTTTTGAGTATGG - Intergenic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079641020 11:22805771-22805793 ATCAAGAAATAATCAGAATATGG - Intronic
1080080337 11:28209784-28209806 AAGTGGAAACATTCAGAGCATGG + Intronic
1081381798 11:42425444-42425466 ATCCAGAAACTTTCATAGTAAGG - Intergenic
1083752760 11:64770206-64770228 ATGAAGACACATGCAGATCATGG - Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1086191527 11:84084852-84084874 AGGAGGAAACATCAAGAGTAAGG - Intronic
1086591903 11:88524825-88524847 ATGATGTTACATTCAAAGTAAGG + Intronic
1087011152 11:93515446-93515468 ATGAGGAAAAAATTAGAGTAAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087903105 11:103664785-103664807 ATGAAGAGACCTTCAGAGATAGG - Intergenic
1088058454 11:105612859-105612881 AAGAAGAAACATGAAGACTATGG + Intronic
1088375151 11:109132690-109132712 AAGCAGAGACATTCAGAGAAGGG + Intergenic
1088384811 11:109242024-109242046 AAGCAGAAATCTTCAGAGTAAGG + Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088853919 11:113729169-113729191 AGGAAACAACATTCAGACTATGG + Intergenic
1089765940 11:120765811-120765833 ATGATGAAACTTCCAGAGGAAGG - Intronic
1090556129 11:127878492-127878514 ATGAAGAAACACACAGAGTGAGG + Intergenic
1091364773 11:135008645-135008667 ATGAAGAATCATCCACAGAATGG + Intergenic
1091521626 12:1250333-1250355 ATGATTAAACATTCAGGCTAAGG - Intronic
1092104257 12:5909924-5909946 ATTTAAAAACATTCTGAGTAGGG - Intronic
1093398417 12:18711882-18711904 ATATAAAAACATTGAGAGTATGG - Intronic
1094433099 12:30391724-30391746 ATGAAGATATATTTACAGTAAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095161462 12:38921876-38921898 ATAAAGAAACATACAGAATTTGG + Intergenic
1095590953 12:43903383-43903405 ATAAAGAAAAATACAGATTAAGG + Intronic
1095858767 12:46891327-46891349 ATGATGAAAAAACCAGAGTAGGG - Intergenic
1096266711 12:50129034-50129056 TTGCAGAAACATTCAGCGAAAGG - Intergenic
1099042508 12:77674109-77674131 ATAAAGAAACATTGATATTATGG - Intergenic
1099796039 12:87400660-87400682 ATGAAGACATCTTCAGAGTCAGG - Intergenic
1100347554 12:93747443-93747465 AAGAAGAAAAATTAAGAGGAAGG - Intronic
1100533858 12:95486929-95486951 ATGAAGACATATTGAGAGCATGG + Intronic
1101737178 12:107471829-107471851 ATGTAGAAAGCTTCAGAGCAAGG - Intronic
1102570347 12:113823535-113823557 ATGAAGAAAGATAAGGAGTAGGG + Intronic
1103489271 12:121304371-121304393 AAGTAGAAATATTCAGAGTATGG + Intergenic
1103648938 12:122418052-122418074 AAGAAAAAACAATCAGAGAAGGG - Intronic
1104322789 12:127767615-127767637 ATGCAGAAACTTTCAGTGAAAGG + Intergenic
1105966716 13:25391293-25391315 ATGAATAGAAATTCAGAGTAGGG - Intronic
1106669216 13:31887055-31887077 AGGAAGAGACAGTCAGTGTAAGG - Intergenic
1106777395 13:33021390-33021412 ATGAAGAAGTTTTCAGAATAAGG + Intronic
1106812368 13:33372014-33372036 ATGAACAGAGATTCAGAGTGGGG - Intergenic
1107516920 13:41138302-41138324 ATGAAGAGACATGCAGAGCAAGG - Intergenic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1108240110 13:48455503-48455525 TTGTAGAAACATCCATAGTAAGG + Intronic
1108781528 13:53842069-53842091 ATTAAGAAACATTCATAATGAGG + Intergenic
1109642146 13:65204290-65204312 ATGAAGAAATATTCAGGTTTTGG + Intergenic
1111613061 13:90629497-90629519 AGGAAGAAACATACAGATAATGG + Intergenic
1111758648 13:92432758-92432780 ATGAGGAAACATCAAGAGTTTGG + Intronic
1112110129 13:96287137-96287159 ATGAAAAAACATTGAGAATTAGG - Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1113064940 13:106363363-106363385 ATGAAGAAATGTACAGGGTATGG + Intergenic
1113183461 13:107658876-107658898 CTGAACAAACAATCTGAGTAGGG - Intronic
1114168392 14:20245772-20245794 ATGATGAAACATTCATATAATGG - Intergenic
1114497200 14:23140985-23141007 ATGAAGAAGCATCCAGGGTTGGG + Intronic
1115037520 14:28876871-28876893 GTGAAGAAAATTTCAGAATAAGG + Intergenic
1116313103 14:43351344-43351366 AAGAAGGAACACTCAGAATATGG - Intergenic
1116350875 14:43861036-43861058 AAGAAGAAACATTTGGAGAAGGG + Intergenic
1116812792 14:49555456-49555478 ATGATCAGACATTGAGAGTAGGG + Intergenic
1117367868 14:55049391-55049413 AAGAAGAAACATTCAACTTAAGG - Exonic
1117399017 14:55341181-55341203 AAGAGGAAACATTTGGAGTAAGG + Intronic
1118634279 14:67733657-67733679 ATTTAGAAACATTCTGAGAAAGG + Intronic
1118878525 14:69805978-69806000 TTGAAGAAACAATCAGAGGATGG + Intergenic
1119628759 14:76207496-76207518 ATGATGAATCATTTAAAGTACGG + Exonic
1119956284 14:78801865-78801887 AGCAAGTAACATTCAGAGGAGGG - Intronic
1120640518 14:87005793-87005815 ATGTAGAAACATACAAAATAAGG - Intergenic
1120788768 14:88560396-88560418 ATTAAAACATATTCAGAGTAGGG - Intergenic
1122167796 14:99842773-99842795 ATAAAACAACATACAGAGTAAGG - Intronic
1122219139 14:100224501-100224523 ATGAAGGAACACCCAGACTATGG + Intergenic
1202837928 14_GL000009v2_random:92155-92177 AGGGACAAACATTCAGACTACGG - Intergenic
1124802847 15:32851163-32851185 ATGCAGAATCATTCAGAATTTGG + Intronic
1125237242 15:37529597-37529619 ATGTTAAAACATTAAGAGTAAGG - Intergenic
1126546852 15:49883410-49883432 AGGAAGGAAAAATCAGAGTAAGG + Intronic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1127920417 15:63490114-63490136 ATGTAGCAATATTCAGAGTTGGG + Intergenic
1129127366 15:73454282-73454304 ATGAAGAAACATGATGACTAAGG + Intronic
1130895744 15:88169312-88169334 ATGTAGAATGGTTCAGAGTATGG + Intronic
1131330533 15:91495222-91495244 ATGAAGAAACATATGGAGTCAGG + Intergenic
1131419086 15:92288402-92288424 AGAAAGAAACATACAGAGCATGG - Intergenic
1131499882 15:92952139-92952161 TTGAAGAAACAGCCAGAGTTAGG - Intronic
1132740404 16:1409261-1409283 ATAAAGGAACGTTCAGAATAAGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1139698356 16:68691636-68691658 ATGAAGAAAGTTTGAGAATACGG - Intronic
1140275050 16:73501489-73501511 CTCAAAACACATTCAGAGTAGGG - Intergenic
1140834997 16:78785321-78785343 CCCAAGAAACATTCAGAGCAGGG - Intronic
1143018942 17:3906474-3906496 ATGTAGAAACACTCAGAATGGGG + Intronic
1143826148 17:9609363-9609385 ATGAAGTAGGATGCAGAGTAAGG + Intronic
1143898540 17:10156085-10156107 AAGAAGAAAAAGTCAGAGTTGGG - Intronic
1144126818 17:12210545-12210567 AAAAAGAAACATTAAGAGTGGGG - Intergenic
1144545432 17:16190676-16190698 AGCAAGAAAAATTAAGAGTAAGG + Intronic
1146766102 17:35523258-35523280 ATGAAGTAACATAAAGAGTCTGG + Intronic
1146967292 17:37043308-37043330 ATGAACAGACATGCAGAATAGGG - Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147811080 17:43170292-43170314 ATCAAGACACAGTCAGAGGAAGG + Intergenic
1148402183 17:47374765-47374787 TTTAAAAAACATTCAGAGAAGGG + Exonic
1148721436 17:49756228-49756250 ATGAAGAAATACTCAGTGTTTGG - Intronic
1148833796 17:50454593-50454615 GAGAAGAAACTTTCAGAGGAAGG - Intronic
1149305141 17:55340166-55340188 ATTAAGAGACATTCTGAGGATGG - Intergenic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1150982047 17:70153716-70153738 ATGAAAAAACATTTAGAGATGGG - Intergenic
1151304181 17:73252433-73252455 ATGAATACACATTAAGAGGATGG + Intronic
1203159743 17_GL000205v2_random:38398-38420 ACGGACAAACATTCAGACTAGGG + Intergenic
1153076712 18:1170538-1170560 ATCCAAAAACATTCAGAGTGTGG + Intergenic
1153308586 18:3655214-3655236 ATGAAGAAACCTCCAAAGCATGG + Intronic
1153354622 18:4121597-4121619 AGGAAGAAACATCAGGAGTAAGG - Intronic
1153716572 18:7855817-7855839 GTGAACACAGATTCAGAGTAAGG + Intronic
1154463036 18:14615700-14615722 ATAAAGAAGCATTAAGAATACGG + Intergenic
1155510382 18:26570341-26570363 ATGGAGTTACACTCAGAGTATGG - Intronic
1156373751 18:36494130-36494152 ATGAAGAAAACTTCAGTGTGTGG - Intronic
1156869663 18:41931013-41931035 ATGAAGAAAAATTCAGGGCCAGG + Intergenic
1157164348 18:45344530-45344552 ATGAAGAGACACTTAGAGCAGGG + Intronic
1157192306 18:45591782-45591804 ATGAAGACACATGCAGAAAAAGG + Intronic
1158050669 18:53214445-53214467 TAGAAGATAAATTCAGAGTATGG + Intronic
1159374136 18:67569708-67569730 ATAAAGATACTTTCTGAGTATGG + Intergenic
1159566966 18:70062298-70062320 AAGAAGATACATGCAGAGAAGGG + Intronic
1159613902 18:70557367-70557389 CTGAAGAATCATTCAGACCAAGG + Intergenic
1159873716 18:73787360-73787382 AGGAAGAATCATTGAGAGTCGGG + Intergenic
1161527745 19:4767621-4767643 TTGAAGGAACAGTCAGTGTAAGG - Intergenic
1162856720 19:13474245-13474267 ATGAAGACAGATTTACAGTAGGG + Intronic
1163040411 19:14598034-14598056 ATGGAGAAATATTCAGACTTTGG - Intronic
1163606502 19:18278756-18278778 ATGAAGAAACTTGGAGAGAATGG - Intergenic
1164275709 19:23715845-23715867 TTCAAGAAACATTCATATTAAGG - Intergenic
1165444651 19:35850219-35850241 ATGAAGAAGCTTTGAGAGTCAGG + Intronic
1165854672 19:38872193-38872215 ATGAATAAACAGTCAGGGTACGG + Intronic
1166226868 19:41401404-41401426 ATGAAGAAATAGTCAGGGAAAGG + Intronic
1167227697 19:48259600-48259622 ATAAACAGACATTCAGTGTAGGG + Intronic
1167837577 19:52086689-52086711 ATTGGGAAACATTCAGAGTCAGG + Intronic
1167849817 19:52192788-52192810 ATGAAGACACATGCAGGGTGAGG + Intronic
1168629151 19:57943720-57943742 ATGTGGAAAGATTCAGAGTTAGG - Intronic
924973323 2:151154-151176 AGCAAGAAACATTCAGAGGAAGG + Intergenic
924978532 2:199123-199145 ATGAAAATAAATTCAGAGCAAGG + Intergenic
925980657 2:9174415-9174437 AGGCAGAAACATTAAGAGAAAGG + Intergenic
927259603 2:21074066-21074088 ATGAAGAACCATTCACAGACTGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931245298 2:60487525-60487547 ATGAATACAGATTCAGATTAAGG + Intronic
932788746 2:74633360-74633382 ATGATCAGACATTAAGAGTAGGG - Intronic
933358071 2:81240052-81240074 TGGCAGAAACATACAGAGTAAGG - Intergenic
935475270 2:103513239-103513261 ATAAAGTAACTTTCAGAGGAAGG - Intergenic
936822017 2:116533434-116533456 ATGCAGTCACATTCTGAGTATGG + Intergenic
936955013 2:118014266-118014288 ACGGAGAAAACTTCAGAGTACGG - Intergenic
936962146 2:118087658-118087680 ATAAATAAAAATTCAGAATAGGG + Intergenic
937601622 2:123743241-123743263 ACAATGAAACATCCAGAGTATGG + Intergenic
937920930 2:127129972-127129994 AGGAAACAACATTCAGAATATGG - Intergenic
938033566 2:128016730-128016752 ATAAAGAAACATACAAAGCAAGG + Intronic
938241108 2:129742807-129742829 TTGAAGAAACATTCTGTCTAGGG + Intergenic
938634875 2:133212661-133212683 ATGAAGAAACATTCACGGCTGGG - Intronic
939385560 2:141492177-141492199 ATTAAGAAACAATGAGAGTAAGG + Intronic
939438722 2:142213647-142213669 ATGAAGATTCATTCAGACTGTGG + Intergenic
939719964 2:145636187-145636209 ATGAGGACACATTCTGAGAAAGG - Intergenic
941101558 2:161301894-161301916 AGGAAGAAATATTTACAGTAAGG + Intergenic
941332606 2:164197210-164197232 AGGATAAAACATTCAGAGCATGG - Intergenic
942340395 2:174938271-174938293 AGGAAGAAAGTTTCAGAGTTAGG - Intronic
942679679 2:178463998-178464020 ATGAAGAAATATTGGGAGGAAGG + Exonic
944002960 2:194863721-194863743 ATGAAAAAAAATCCAGAGAAGGG - Intergenic
945735319 2:213591747-213591769 AAGAAGAAACATGAGGAGTAAGG + Intronic
945859464 2:215104249-215104271 AAGTAGAAAAATTAAGAGTAAGG - Intronic
946614946 2:221499129-221499151 AAGCATAAACATTCAGAGTTAGG - Intronic
946940644 2:224766948-224766970 ATGAAGGAACCTTCAGTATAAGG - Intronic
947304907 2:228734776-228734798 ATGCAGAATCATAAAGAGTAGGG - Intergenic
947507095 2:230716141-230716163 ATGAAGTAAGATGCTGAGTAAGG + Intronic
1168878634 20:1187217-1187239 ATAGAGAAAAATTCAGAGTGAGG - Intronic
1169484407 20:6014882-6014904 ATGCAGATACAGTCAGAGTATGG + Intronic
1170255445 20:14338060-14338082 TTGAATAAACATTCACAGTTGGG - Intronic
1170343443 20:15355384-15355406 ATGAAGAGACATACAGGATAAGG + Intronic
1170525860 20:17237066-17237088 CTTAAGCAACATTCAGATTAGGG + Intronic
1172609753 20:36241371-36241393 ATGAAAAAACATTTATATTAAGG - Intronic
1174710109 20:52695475-52695497 CTTAATAAACACTCAGAGTATGG + Intergenic
1175608709 20:60332430-60332452 ATGAAGAAACATGTAGGGTGAGG + Intergenic
1176811488 21:13542671-13542693 ATAAAGAAGCATTAAGAATACGG - Intergenic
1178550805 21:33537652-33537674 ATGAGGAGACAGTCATAGTAAGG + Intronic
1179255609 21:39712851-39712873 AAGAAGAAAAATTCAAAGTTTGG - Intergenic
1180202173 21:46230540-46230562 ATGTAGAAACATGAAGAATAGGG + Intergenic
1181771397 22:25128266-25128288 ATGAAGAAACATTAAGGGATTGG - Intronic
1183768384 22:39900664-39900686 AAGAAGAAACATTCTGAGCTGGG - Intergenic
1183984552 22:41562288-41562310 AGGAGGAAACATTCAGAATTTGG - Intronic
949176787 3:1073088-1073110 ATGAACAAACATACAGAATAAGG - Intergenic
949373121 3:3356599-3356621 ATGAAGAAATAGTAACAGTAGGG + Intergenic
949518404 3:4827682-4827704 AATAAGCAACATTCAGAGTGCGG + Intronic
950532375 3:13559773-13559795 ATGGAGAACCATTCAGGGTTTGG + Intronic
950970935 3:17187171-17187193 ATGAAGCAACATGCAGAGTCAGG - Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951371333 3:21853124-21853146 AAAAAGATACATTTAGAGTAGGG + Intronic
951513269 3:23528370-23528392 TTGAAGGAAAATACAGAGTAGGG + Intronic
951899174 3:27640209-27640231 AAGAAGAAATATTTAGATTATGG + Intergenic
951975387 3:28501668-28501690 ATGAGGAAACTTTCTGGGTAAGG - Intronic
953182230 3:40606671-40606693 TTGAATAATCATCCAGAGTAAGG + Intergenic
953466217 3:43122162-43122184 GGGAAGAAACATGCAGAGCAGGG - Intergenic
953492050 3:43360933-43360955 ATGAGGAACCATTCAGATTCAGG + Intronic
954269861 3:49499473-49499495 ATGAGGAAACATTAAGTTTATGG + Intronic
955058367 3:55475212-55475234 TTGAAGGAACACTCAGAATATGG + Intronic
956539085 3:70314029-70314051 ATGAAGAAGCCTTCAAGGTAGGG - Intergenic
957233552 3:77553652-77553674 ATGAAGAAAGTTTTAGAGTCTGG + Intronic
957457805 3:80474405-80474427 ATGGAGAAAACTTCATAGTAAGG - Intergenic
958476876 3:94595318-94595340 CTGAAGTAACATTGAGAGTTAGG + Intergenic
959099663 3:101996066-101996088 ATTGAGAAACATTCAAAATATGG - Intergenic
959380337 3:105633816-105633838 ATTGAGAAACTTTCAGATTATGG + Intergenic
959384485 3:105685025-105685047 ATGAAGAAAAATTCTAAGGAAGG + Intronic
961853376 3:129844344-129844366 AGAAAGAAACATACAAAGTATGG + Intronic
962599739 3:136982668-136982690 ATGGAGGCACAATCAGAGTAGGG - Intronic
962940439 3:140120338-140120360 ATAAAGAAACATGTAGAGTGAGG + Intronic
963066749 3:141270177-141270199 ATGAAGCAACATTAAGAATGAGG + Intronic
963694684 3:148551357-148551379 ATGAAGATAGATTCAGAATTGGG - Intergenic
963731093 3:148973423-148973445 ATGCAGAAAAATCCAGAGTTTGG + Intergenic
963802199 3:149687316-149687338 ATGAAGAAATGATCAGAGTCAGG - Intronic
964491415 3:157240329-157240351 ATGACTAAATATTCAGAGTTAGG - Intergenic
964903732 3:161692744-161692766 ATGAAGAGATATACAGAGTGAGG - Intergenic
965381103 3:167989625-167989647 TTTGAGAAACATTCAGAGAATGG + Intergenic
965388230 3:168071803-168071825 TTAACAAAACATTCAGAGTAAGG - Intronic
965899272 3:173618655-173618677 ATGAAGGAGCATTTTGAGTATGG + Intronic
966111623 3:176409053-176409075 AAGAAGAAAGATGAAGAGTAGGG + Intergenic
966181487 3:177192848-177192870 ATGAAGAAACAAACACATTAGGG + Intronic
968032041 3:195508529-195508551 ATGAGGAAACATTAATAGAAAGG + Intergenic
969561155 4:7949228-7949250 ATGGAAAAACATTCAGGATAAGG - Intergenic
969935561 4:10677069-10677091 ATGGAGAAACAATCACAGTTGGG - Intronic
970911304 4:21279237-21279259 ATGAAGCAGAATTCAGAGTTAGG + Intronic
971571971 4:28224248-28224270 AAGAGGAAACATTCTAAGTAGGG - Intergenic
971776947 4:30978002-30978024 ATCAAAGAAAATTCAGAGTATGG - Intronic
971796141 4:31230746-31230768 ATGAGGACAATTTCAGAGTATGG + Intergenic
972230347 4:37065253-37065275 ATGAAGAAAAAGTCAGTGTTAGG + Intergenic
973930441 4:55788342-55788364 ATGAAGAATCATTCAGTGAATGG - Intergenic
976853078 4:89571467-89571489 ATTAAGAAAGATTCAGACTTTGG + Intergenic
976885800 4:89982508-89982530 ATGAAGCACCATTCAGATGATGG - Intergenic
977177446 4:93834570-93834592 ATTAAGAAACACTCACATTACGG - Intergenic
977891701 4:102319576-102319598 AAGAGGAAACATTAAGGGTAGGG - Intronic
978420010 4:108521784-108521806 ATGAATAAACATGTAGAGTTAGG - Intergenic
978697988 4:111606287-111606309 ATCAAGAGACATGCAGTGTAAGG - Intergenic
978751915 4:112259383-112259405 ACGAAGACAGATTAAGAGTATGG - Intronic
979021158 4:115500465-115500487 ATCAAGAAACATGCAGAAGAGGG - Intergenic
979429664 4:120613663-120613685 TAGAAGAAACATTCAAAATATGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980103511 4:128565344-128565366 AAGAAGAGATATTAAGAGTAGGG - Intergenic
980113551 4:128657931-128657953 ATGAAGAAACTTTTACTGTAAGG + Intergenic
981219567 4:142215604-142215626 ATGAAGCAACATGCAGAGACTGG - Intronic
981885066 4:149664942-149664964 ATGAAAAGACCTGCAGAGTAAGG - Intergenic
982135734 4:152272468-152272490 GGGAAGAAACATACAGAGTCTGG - Intergenic
982341390 4:154302733-154302755 ATGAAGAGACATGCAGAGCCAGG + Intronic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983502640 4:168516955-168516977 GTGTAGAAACATTCAGTGTTGGG + Intronic
983728731 4:170966242-170966264 ATTAAGAAAAATGCATAGTAAGG + Intergenic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
984328517 4:178285109-178285131 ATGAAGAAACATTTGGACCACGG + Intergenic
984435163 4:179700886-179700908 TTGAAGATACATTCTGAGAAAGG - Intergenic
984495678 4:180494418-180494440 ATGAGGAAATATTCAGTTTAAGG + Intergenic
985358937 4:189151879-189151901 ATGTAGAAACATTCACATTTAGG - Intergenic
985815122 5:2122427-2122449 ATGAAGAAATTATCAGAGGAAGG - Intergenic
988176638 5:27735038-27735060 ATAAAGATGCATTCAGTGTAAGG - Intergenic
988413066 5:30911823-30911845 CTGAAGAAAAATACAGAGTGAGG - Intergenic
988468969 5:31519035-31519057 AAGAAGAAACATTGGGAGTTTGG - Intronic
988531088 5:32027786-32027808 ATGAATAACCATTCAGAAAATGG - Intronic
990246795 5:53871190-53871212 ATGAAGGAGAATTCAGAATAGGG - Intergenic
990644959 5:57833662-57833684 ATGAAGCAACATTAAAAGAAGGG - Intergenic
990769688 5:59229031-59229053 ATGGAGAAAAATTAAGAGTAAGG - Intronic
991710198 5:69401311-69401333 ATGTAGAAACATGCAGAATGAGG + Intronic
992173694 5:74128642-74128664 ATGGAGGAAGATTGAGAGTATGG + Intergenic
993411543 5:87579736-87579758 ATGAAGAGACATACAAGGTAAGG - Intergenic
995532181 5:113102652-113102674 AAGAAGAAACATGCATATTAGGG + Intronic
996058610 5:119008144-119008166 ATGAAGAAACAATGAGAAGATGG - Intergenic
996310923 5:122104057-122104079 ATGAAAAAAAATTCACAGTAAGG + Intergenic
996434481 5:123419723-123419745 CTGAAGACATATTCAGAGTCAGG + Intronic
996976625 5:129441676-129441698 AAGAATAGACATTCAGAGTTTGG + Intergenic
998019541 5:138757847-138757869 ATGAGGCAACAGTCAGATTATGG + Intronic
998333323 5:141348579-141348601 ATGAAAATACACTGAGAGTATGG + Intronic
998970381 5:147584814-147584836 AAGAAGTAATATTCAGAATAAGG + Intergenic
999894082 5:156009624-156009646 ATAAAGAAACAATCAGGTTATGG + Intronic
1000286340 5:159829306-159829328 ATGCAGAAAGTTTCAGAGTCAGG - Intergenic
1000594136 5:163194476-163194498 AAGAAGAAGCATTAGGAGTAAGG - Intergenic
1000679422 5:164164346-164164368 ATGAATTAACCTTCAAAGTATGG - Intergenic
1000854705 5:166383776-166383798 ATGAATCAACATTCAGAAAAGGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1006576368 6:35049405-35049427 CTAAAGAACCATTCAGGGTAAGG - Intronic
1006976036 6:38102425-38102447 ATGGAGAAACACTGAGTGTAGGG - Intronic
1007162746 6:39805491-39805513 ATGAGGAAATATTCTGAGTTGGG + Intronic
1008653064 6:53583253-53583275 ATGGAGAAATAGTAAGAGTAAGG - Intronic
1008831418 6:55767472-55767494 ATGAGGAAACAGTCAGAGAGAGG + Intronic
1009360842 6:62810696-62810718 ATGAAGAAACAGTCAAGGGAAGG + Intergenic
1009616830 6:66019819-66019841 ATAAAAAAAAATTCAGAGGATGG + Intergenic
1009779318 6:68249223-68249245 ATGAAAAAAAATTCAGACTTAGG + Intergenic
1009817889 6:68759677-68759699 TTTAAGAAACATTCACATTAAGG - Intronic
1010167041 6:72927676-72927698 TTAAAGAAAAATACAGAGTATGG - Intronic
1010874077 6:81079670-81079692 ATGAATAACCATTCATAGGATGG - Intergenic
1011325123 6:86142364-86142386 ATTAAGAAAAATTCAAAATATGG - Intergenic
1011654247 6:89535369-89535391 CTGAGGAAACATGCAGACTATGG - Intronic
1011856577 6:91700438-91700460 AAGAAAAAACCTTCAGAGTCAGG + Intergenic
1012196193 6:96343915-96343937 AAGAAGAAAAATTCAGAATGTGG + Intergenic
1012577947 6:100826695-100826717 ATGAATCAACATTCAGAGTAAGG + Intronic
1012577953 6:100826770-100826792 ATGAACCAAAATTCAGAGTAAGG + Intronic
1013630528 6:111981992-111982014 ATGGCGAAAGATTCAGAGTGGGG + Intergenic
1014119738 6:117711006-117711028 AAAAAGAAAAATTCAGAATATGG + Intergenic
1016603092 6:145885953-145885975 AATAAGAAAAATTAAGAGTAGGG + Exonic
1019582779 7:1775465-1775487 ATGAAGATATTTTCAGAGGAAGG - Intergenic
1021259650 7:18439252-18439274 ATGAAGAAAAAAGCAGAATAGGG - Intronic
1021314503 7:19130597-19130619 TTGAAGACACATTCTGAGAATGG - Intergenic
1021804532 7:24342036-24342058 AAGAACAAACATTCAAACTATGG + Intergenic
1021837371 7:24692899-24692921 AGAAAGAAACATTCACAGTGAGG + Exonic
1022333903 7:29405125-29405147 ATAAAGAAACATTCTCTGTATGG + Intronic
1023183519 7:37510503-37510525 ATGAAAAAACATTCTGAAGATGG - Intergenic
1023443289 7:40206325-40206347 TTGAAGAAACATGCAAAGAATGG - Intronic
1024754113 7:52508022-52508044 ATGAGGAAAAAATAAGAGTAAGG + Intergenic
1026167041 7:67919524-67919546 AAGTGAAAACATTCAGAGTATGG - Intergenic
1026363475 7:69624752-69624774 ATGGAGAGCCATTCAGAGCAGGG - Intronic
1027546800 7:79537255-79537277 ATGAAGAAATAGTCAGTATAAGG + Intergenic
1027617400 7:80440550-80440572 AAGAAGTAAGATTCAGACTAGGG - Intronic
1027671564 7:81105719-81105741 AAGAGGAAACATTATGAGTAAGG + Intergenic
1028066030 7:86385652-86385674 ATCAACAAATATTCAGAGTATGG + Intergenic
1028363496 7:89997334-89997356 TTGAAGGAACATTCAGAACACGG - Intergenic
1030171017 7:106602834-106602856 ATGAAGAAAACTCCAGAGTTAGG - Intergenic
1031348042 7:120693510-120693532 ATGAAAAAAAATTGAGAGGAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033014526 7:137659032-137659054 ATGAAGAAAAATTTAGAATATGG - Intronic
1034064617 7:148124349-148124371 ATGAAGAAAAGTTTAGAGTCTGG - Intronic
1036479285 8:9123964-9123986 ATGAGGACAGATTCAGAGCAGGG - Intergenic
1037147802 8:15594587-15594609 TTGGAGCAACATTCAGTGTAGGG + Intronic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1038120075 8:24603350-24603372 ATGAAGAAAAAATCAGAGCCAGG - Intergenic
1039576962 8:38631432-38631454 ATGAGCAAAAATACAGAGTAGGG - Intergenic
1041835307 8:62205645-62205667 ATAAAGAAAAATTAGGAGTAAGG - Intergenic
1042180902 8:66087066-66087088 ATAAAGATACAACCAGAGTATGG + Intronic
1042629118 8:70797181-70797203 ATGAGGTAACAGTCAGAGTGAGG + Intergenic
1043494861 8:80789907-80789929 AAGAAGAAATAGTCAGAGAAAGG + Intronic
1045093204 8:98768731-98768753 ATGAGGAACCATTCAGGGAAGGG - Intronic
1045709994 8:104972125-104972147 ATGAAGCTACATCCAGAGAATGG - Intronic
1045981070 8:108188189-108188211 ATCAAGAAACATTCATAAAATGG + Intergenic
1046564113 8:115876670-115876692 ATGAAGAGACATTAAAAATAAGG + Intergenic
1046767635 8:118087213-118087235 AGGAAAAAAAATTCAGAGTGTGG - Intronic
1047215887 8:122875790-122875812 ATGTAGAAAAATTCAGAGTCAGG - Intronic
1048495573 8:134933022-134933044 ATGAAGAGACATTCAGGTTAAGG + Intergenic
1049529106 8:143145118-143145140 ATGAGCAAACATTTAGAGTCTGG - Intergenic
1050518102 9:6466956-6466978 ATTCAGAAAAAGTCAGAGTAAGG - Intronic
1052138981 9:24954478-24954500 ATGAATAAAGATTCAGATTCTGG - Intergenic
1052416783 9:28188079-28188101 AAGTAGAAACATTTAGAGTCCGG - Intronic
1054075399 9:60524169-60524191 AGGAATAAACACTCAGAGCATGG + Intergenic
1055369241 9:75579362-75579384 ATGAAGAACCAATCAGAGTTGGG + Intergenic
1056588005 9:87940769-87940791 ATGAAGAAACAACCAGAGAATGG - Intergenic
1056608862 9:88112176-88112198 ATGAAGAAACAACCAGAGAATGG + Intergenic
1056615002 9:88157828-88157850 ATAAAGACACATTCAGATGAAGG - Intergenic
1056805952 9:89729015-89729037 CTGAAGAAACCTTCAAAGGAGGG + Intergenic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1058136806 9:101316560-101316582 ATGAAGAAACAAAGAAAGTATGG + Intronic
1059125823 9:111683801-111683823 AAGAAGAACCATTGAGATTATGG - Intergenic
1059521872 9:114950293-114950315 ATTAAGAAGCATTTAGAGAAGGG - Intergenic
1203493761 Un_GL000224v1:131433-131455 AGGAAGAAACAGTCAGAATCCGG - Intergenic
1203506381 Un_KI270741v1:73308-73330 AGGAAGAAACAGTCAGAATCCGG - Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1188982417 X:36738939-36738961 ATGAAAAAAAATTCAGCCTAGGG - Intergenic
1188985642 X:36766251-36766273 ATGAAGGGACATGCAGAATAAGG - Intergenic
1189610486 X:42728199-42728221 AGGAAAAAACATTCAGAATGAGG + Intergenic
1190039574 X:47058953-47058975 ATAAAGAAAAAGTCAGGGTAAGG + Exonic
1192810737 X:74545101-74545123 ATGAAGAAATATACAGGGTGAGG - Intergenic
1192896172 X:75444803-75444825 ATAAAAAAAAATTCAGAGGAAGG + Intronic
1193024365 X:76829287-76829309 AAGAAGAAACATTATGGGTAAGG - Intergenic
1193815237 X:86097159-86097181 ATGGAGGAACATTCATAGAATGG - Intergenic
1193865345 X:86724192-86724214 ATAAAGAAACATAGAGAATAAGG - Intronic
1194072762 X:89348266-89348288 ATCAATAAAAATTCAGAATAAGG - Intergenic
1194549793 X:95282805-95282827 ATGAAGAATAATACAGAGGATGG - Intergenic
1198070956 X:133148140-133148162 ATGAAGACAAATTCCGAGAATGG + Intergenic
1199483153 X:148320525-148320547 ATATAGAGACATTCAGTGTAAGG + Intergenic
1199524288 X:148775014-148775036 ATGAATAAACATTCAAAATAAGG - Intronic
1201488895 Y:14520624-14520646 AAGGAAGAACATTCAGAGTAGGG - Intergenic
1202127026 Y:21577617-21577639 AGGAAGAAACATTGAGGGAATGG - Intergenic
1202152229 Y:21853913-21853935 AGGAAGAAACATTGAGGGAATGG + Intergenic