ID: 1127842331

View in Genome Browser
Species Human (GRCh38)
Location 15:62842288-62842310
Sequence TGTGGGCACCAGTTCTGAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127842331 Original CRISPR TGTGGGCACCAGTTCTGAAG AGG Exonic
900521352 1:3106863-3106885 AGTGGGCACCTGTTCTCTAGTGG + Intronic
901160670 1:7174595-7174617 TGGGGGGACCACTTCTGAGGGGG + Intronic
902239053 1:15076129-15076151 TGTGGGCACCAGAGCTGTGGTGG + Intronic
903145425 1:21368925-21368947 TGTGGGCACCAGGAGGGAAGGGG + Intergenic
905388472 1:37621038-37621060 GGTGGGCAGCAGATCTGAAAGGG - Intronic
905813491 1:40930303-40930325 TGTGAACAGGAGTTCTGAAGAGG + Intergenic
907757776 1:57327512-57327534 GTTTGGCAGCAGTTCTGAAGAGG - Intronic
908664544 1:66475549-66475571 TGTGTGCAGGAGTTGTGAAGGGG + Intergenic
915548445 1:156617321-156617343 TGAGGTCTCCAGTTCTGAAAGGG + Intergenic
921155359 1:212434123-212434145 TTTGGGCATCATTTGTGAAGGGG + Intronic
923228847 1:231964583-231964605 TCTGGCCTCCTGTTCTGAAGTGG - Intronic
1065259314 10:23908358-23908380 TGAGAGCACCAGTTCTGAAGGGG - Intronic
1065339988 10:24695775-24695797 TGAGGGCCTCAGTTCTTAAGGGG - Intronic
1070289367 10:75104638-75104660 TGTGGGTAGAAGGTCTGAAGGGG - Intronic
1071121501 10:82284128-82284150 TATTGGCTCCTGTTCTGAAGTGG - Intronic
1071439076 10:85674317-85674339 CTTGGGCACCCGTTCTGAGGGGG - Intronic
1074734169 10:116411021-116411043 GGTGGGCAACAGCTCTGAAAAGG - Intergenic
1076944207 10:133633183-133633205 TGTGGGCACCAGCTCAGGAGAGG - Intergenic
1077287357 11:1773490-1773512 TGTGGGGCCCAGTTCTGCACTGG + Intergenic
1081854245 11:46294181-46294203 TGTGGTGACCAGTTCGGTAGGGG + Intronic
1083364521 11:62133449-62133471 ATCGGGCAGCAGTTCTGAAGTGG + Intronic
1084032154 11:66487399-66487421 AGTGGTCACCAGTTGTGAGGGGG - Intronic
1088854141 11:113731474-113731496 TGAGGGTACCTGTTCTGATGGGG - Intergenic
1089608906 11:119658499-119658521 TGTGGGCACCGGTACAGAGGTGG + Intronic
1092936432 12:13368253-13368275 TGTGAGCAGCAGGCCTGAAGTGG + Intergenic
1094709743 12:32949680-32949702 TGTGGTCACCTGAGCTGAAGGGG + Intergenic
1096208284 12:49741801-49741823 CGTGCGCAACAGTGCTGAAGCGG + Exonic
1096227383 12:49874871-49874893 TCTGGGCAGCAGTGCTGAGGTGG + Intronic
1097606161 12:61757147-61757169 AGTGGAGACCAGTTATGAAGAGG + Intronic
1100283126 12:93137810-93137832 TGTTGGCACCAGAGATGAAGGGG - Intergenic
1103454214 12:121052197-121052219 TGAGTGCCCCAGTCCTGAAGGGG - Intergenic
1103907490 12:124335071-124335093 TGGGGGCACCAGGCCTGGAGAGG - Intronic
1108473262 13:50788330-50788352 TGTGGGCACCAGTTCTGGGCTGG + Intronic
1111823700 13:93243561-93243583 TGCGAGCACCAGCTCTGATGGGG + Intronic
1113602770 13:111582538-111582560 TGTTGGCCCCAGTGTTGAAGTGG + Intergenic
1114032334 14:18588108-18588130 GATGGGCACCAGTTATCAAGTGG + Intergenic
1114077115 14:19167134-19167156 GATGGGCACCAGTTATCAAGTGG + Intergenic
1114085048 14:19232430-19232452 GATGGGCACCAGTTATCAAGTGG - Intergenic
1114233337 14:20803095-20803117 TTTGGGCACCAGTGCTGTAGTGG - Exonic
1114630664 14:24157588-24157610 TGCCGCCACCAGTTCTGCAGCGG + Exonic
1115405531 14:33011335-33011357 TGTGGGGACCAGCCCTGGAGAGG + Intronic
1117074794 14:52091129-52091151 TGTGGGCACCAGCACTGGCGTGG - Intergenic
1118134744 14:63011051-63011073 TGTGGTCTCCAGCTCAGAAGTGG + Intronic
1202896625 14_GL000194v1_random:14139-14161 GATGGGCACCAGTTATCAAGTGG - Intergenic
1202927017 14_KI270724v1_random:35895-35917 TGTGGGTACCAGCTCAGGAGAGG + Intergenic
1125770846 15:42164868-42164890 GGTGCGCAGAAGTTCTGAAGAGG - Intronic
1127842331 15:62842288-62842310 TGTGGGCACCAGTTCTGAAGAGG + Exonic
1128156524 15:65395104-65395126 TGTGTGCACCAGTGCTGGGGTGG + Exonic
1131279051 15:91006269-91006291 TGTGGGCCCCAGCTCTGAGAGGG - Intronic
1131407246 15:92175506-92175528 TATGGCCCCCAGTTATGAAGTGG - Intergenic
1132187675 15:99816575-99816597 TGTGGGCATCAGAACTGATGAGG - Intergenic
1134080295 16:11320103-11320125 TCAGGGAACCAGTGCTGAAGAGG - Intronic
1137003240 16:35250313-35250335 TGTGGGCACCAGCTCAGGAGAGG - Intergenic
1137012842 16:35340644-35340666 TGTGGGCACCAGCTCAGGAGAGG - Intergenic
1137765367 16:50973720-50973742 TGAGGGCATCAGTACTGCAGGGG - Intergenic
1138598691 16:58042659-58042681 TGGGGGCACCTGTTCTTATGAGG - Intronic
1140778610 16:78273721-78273743 TTTGGCCAACAGCTCTGAAGGGG + Intronic
1141308192 16:82887126-82887148 TTTGGGCACAAGTTCGAAAGTGG - Intronic
1141961793 16:87413799-87413821 TCTGGGCACCAGTCCTGGGGTGG + Intronic
1142914556 17:3125599-3125621 TGTGGACATCAGTTATGAACTGG + Intergenic
1146321836 17:31852965-31852987 TGAGGGCACCCATTCTGAAGAGG - Exonic
1147707413 17:42436257-42436279 TTTGAACACCAGTTCTGAATTGG - Intergenic
1149470257 17:56910616-56910638 TGTGGGCACCATTCATGATGAGG - Intronic
1150523106 17:65890461-65890483 TGGGGGCATCAGGTCTGAGGAGG - Intronic
1154409064 18:14126063-14126085 TGTGAGCACCAGCTGTGGAGAGG + Intronic
1157743479 18:50114431-50114453 TGTGGGCACCCTTTCCCAAGAGG - Intronic
1157812995 18:50710983-50711005 GGTGGGCACCAGTTCTGATCTGG - Intronic
1158805562 18:60967748-60967770 TGAGGGCACCAGCTCTTTAGTGG - Intergenic
1158844978 18:61432384-61432406 TCTGGGCACCAGTTGTGGATGGG - Intronic
1159077742 18:63700646-63700668 TGAGGCCACCAGTTCTGCATAGG + Intronic
1159218576 18:65429027-65429049 TGGGGGCACCAGTGCTGATTGGG - Intergenic
1159331954 18:67006299-67006321 TGTGGGCAAAATTTCTGAATAGG - Intergenic
1159998791 18:74995418-74995440 TGGGTGGACCAGTTGTGAAGTGG + Intronic
1160187381 18:76686141-76686163 TGTGGCCACCAGTGCTGCACAGG + Intergenic
1160616952 18:80137614-80137636 CGTGTGCACCATTTCTAAAGTGG + Exonic
1161092210 19:2366927-2366949 TGAGGACACCAGCTTTGAAGTGG - Intergenic
1162461900 19:10818382-10818404 CATGGGCACCAGCTCTGCAGTGG + Intronic
1164808930 19:31140832-31140854 TGTGGGGACCTCTTCTGGAGGGG + Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
926916241 2:17894727-17894749 TGTAGGCACCATCTCTGAACAGG - Intronic
930108492 2:47658341-47658363 TGTGGACTCCAGGTCTGGAGGGG - Intergenic
931128031 2:59299117-59299139 TAAGGACACCAGTTCTGAACTGG - Intergenic
932452018 2:71817116-71817138 TCTGGGAGCCAGTTCTCAAGAGG + Intergenic
935111537 2:100098928-100098950 TGTGGGCAGCAGTGGGGAAGGGG - Intronic
936123431 2:109766236-109766258 TGTGGGCAGCAGTGGGGAAGGGG + Intergenic
936221254 2:110605228-110605250 TGTGGGCAGCAGTGGGGAAGGGG - Intergenic
938495850 2:131797694-131797716 GATGGGCACCAGTTATCAAGTGG - Intronic
940330721 2:152471586-152471608 TGTTGGCTCCAGTTCTGGAGTGG - Intronic
940733362 2:157420204-157420226 GGTGCACACCAGTTCTTAAGAGG + Intronic
948977064 2:241470331-241470353 TGGGGGAACCTGTTCTGAGGGGG + Intronic
949044729 2:241867201-241867223 GGTGGGCAGCAGTGCTGAAGGGG + Intergenic
1168999841 20:2160726-2160748 TCTGGGCACGAGATCTGCAGAGG - Intronic
1169069390 20:2713753-2713775 TGTGGACATCAATTCTGATGGGG + Intronic
1170500248 20:16968285-16968307 TGTGACCATCAGTCCTGAAGAGG + Intergenic
1171099024 20:22364871-22364893 TGTAGGCACCTGATGTGAAGGGG + Intergenic
1171201290 20:23244576-23244598 TCTGGGCGCCAGTCCTGATGGGG - Intergenic
1171781567 20:29423340-29423362 CGTGGGCACCAGCTCAGGAGAGG - Intergenic
1174353677 20:49984630-49984652 TGTGGGGGCCAGGTGTGAAGGGG + Intronic
1176092878 20:63326677-63326699 TCTGGGAACCAGGGCTGAAGTGG + Intronic
1176616313 21:9030135-9030157 GATGGGCACCAGTTATCAAGTGG - Intergenic
1176708820 21:10133495-10133517 GATGGGCACCAGTTATCAAGTGG + Intergenic
1176864150 21:14033824-14033846 TGTGAGCACCAGCTGTGGAGAGG - Intergenic
1178302275 21:31463095-31463117 TGTGGTCACCAATTCAAAAGAGG + Intronic
1178761150 21:35404080-35404102 CGTGGACACCAGTGCTGAAATGG - Intronic
1180072382 21:45442883-45442905 TGTGGGCAGCGGTGCTGATGTGG + Intronic
1180072396 21:45442940-45442962 TGTGGGCAGCGGTGCTGATGTGG + Intronic
1180292920 22:10860763-10860785 GATGGGCACCAGTTATCAAGTGG + Intergenic
1180456445 22:15515165-15515187 GATGGGCACCAGTTATCAAGTGG + Intergenic
1180495727 22:15890185-15890207 GATGGGCACCAGTTATCAAGTGG + Intergenic
1180592913 22:16956050-16956072 TGTGGGCAGCAGTACAGAATGGG - Intergenic
1180940423 22:19657016-19657038 GGTGGACACCAGGTCTCAAGGGG + Intergenic
1183805373 22:40205326-40205348 TTTGTGCACCAGTACTGAAAAGG + Intronic
1184050226 22:41998739-41998761 TGTGGGGCGCGGTTCTGAAGGGG - Intronic
1185048223 22:48539869-48539891 TGCCGCCACCAGTGCTGAAGGGG + Intronic
1185057196 22:48587241-48587263 TGTGGGCACGAGTTCTGGAGGGG + Intronic
1185296533 22:50057731-50057753 TGTGGGCATCAGGTCTCAATTGG + Intergenic
953627967 3:44586287-44586309 TGTGGGCACCAGGGTTGAAAGGG + Intronic
954195963 3:48997413-48997435 GGTGGGCTCCAGCTCTGCAGGGG + Intronic
954453318 3:50583418-50583440 TATGGAATCCAGTTCTGAAGAGG + Exonic
955160344 3:56459182-56459204 TGTGGTTACCAGTTCTTATGTGG - Intronic
955740653 3:62088077-62088099 TAATGGCAGCAGTTCTGAAGTGG + Intronic
956695205 3:71912934-71912956 TGTGCGGCCCAGTTCTGAACAGG + Intergenic
959300039 3:104587448-104587470 TGTGGGAACCAATGCTGAGGAGG + Intergenic
960998695 3:123357748-123357770 TCTGGGCACCAGGTCTTAAAGGG + Intronic
961117083 3:124339577-124339599 ACTGAGCACTAGTTCTGAAGGGG - Intronic
961360440 3:126364109-126364131 TGTGGACAACAGTGCTCAAGAGG - Intergenic
961504529 3:127361307-127361329 TGTGGGCACCAGAGCTGCGGGGG + Intergenic
962110745 3:132444049-132444071 TGTGGGGCCCAGTTCTTAAGAGG - Intronic
962496471 3:135945244-135945266 TCAGGGCACCAGTTCCTAAGGGG + Intergenic
963209011 3:142667813-142667835 TATGGGAAACAGTTCTGAACTGG + Intronic
968377795 4:58141-58163 TGGGAGCACCAGCTCTGGAGAGG - Intronic
968385150 4:129492-129514 TGTGAGCACCAGCTCTGGAGAGG - Intronic
968394100 4:217336-217358 TGGGAGCACCAGCTCTGGAGAGG - Intergenic
968406249 4:341788-341810 TGTGGGCACCAGCTCTGGAGAGG - Intronic
970783499 4:19767927-19767949 TGTGGGCTCAAGTGCTGATGTGG + Intergenic
972577023 4:40361309-40361331 TCTGGGCCCCAGGTCTGGAGAGG - Intergenic
973882402 4:55287073-55287095 TGTGGGCCCCAGAGGTGAAGAGG + Intergenic
974110005 4:57514273-57514295 GGTGGGGACCTGTTCTGCAGAGG + Intergenic
975994873 4:80302708-80302730 TGTGGGCGCCAAGGCTGAAGAGG - Intronic
976061904 4:81138225-81138247 TGGGGGCCTCAGTTCCGAAGCGG + Intronic
978633878 4:110780596-110780618 TGTGTACTTCAGTTCTGAAGGGG - Intergenic
980689366 4:136274384-136274406 TGTGGGCACCAGAACAGCAGGGG + Intergenic
985447577 4:190033726-190033748 TGTGGGCACCAGCTCAGGAGAGG - Intergenic
985550622 5:531709-531731 TGTGTGCACCAGGTGTGCAGTGG + Intergenic
986351611 5:6885449-6885471 TGTGGGGTCCAGAGCTGAAGAGG - Intergenic
987423033 5:17743353-17743375 TGTGGACACGAGTTGTGGAGAGG + Intergenic
988982327 5:36584129-36584151 TGTGGGCACCAGGAGAGAAGAGG - Intergenic
990889281 5:60631505-60631527 TGTGGAAACCAGATCTGAAAAGG + Intronic
997528873 5:134570193-134570215 TGTGGGCAGCAGGTATGAGGTGG - Intronic
999127245 5:149254720-149254742 AGTGTCCACCAGTGCTGAAGGGG + Intronic
999267322 5:150275359-150275381 TCTGGCCACCAGCTATGAAGGGG + Intronic
1001337383 5:170810669-170810691 GGTGGGCACCTCTTCTGAACTGG - Intronic
1002720826 5:181260689-181260711 TGTGGGCACAACTTCTGCCGAGG - Exonic
1004423154 6:15489268-15489290 TATGGCCTCCAGTTCTGATGTGG - Intronic
1006056548 6:31389474-31389496 TGTGGGGGCCAGTTGTGGAGTGG + Intergenic
1006069273 6:31486453-31486475 TGTGGGGGCCAGTTGTGGAGTGG + Intergenic
1006546923 6:34787833-34787855 TGTGGGCAAAAGATATGAAGAGG + Intergenic
1008071196 6:47100726-47100748 TCTGGGAACCAGTTCTGAAATGG + Intergenic
1014154539 6:118095223-118095245 TGGGGACAGAAGTTCTGAAGTGG + Intronic
1015318730 6:131847105-131847127 TGTGGGAACGAGCCCTGAAGAGG - Intronic
1021503458 7:21354900-21354922 TGTAGGCAGAAGTTCTAAAGCGG - Intergenic
1024400008 7:48913443-48913465 TGTGATCTCCAGTTTTGAAGTGG + Intergenic
1024504502 7:50150263-50150285 TCTGGGCACCAATTTTGAATAGG + Intronic
1025774472 7:64547892-64547914 TATGGGCACCAGTTCTAAAAAGG + Intronic
1025799002 7:64766601-64766623 TGTGAGCACCAGCTCTGGAGAGG - Intergenic
1026462667 7:70628836-70628858 TCTGGGCGCCATTTCTGAACCGG + Intronic
1027363473 7:77433077-77433099 TCTGGCCAGGAGTTCTGAAGTGG + Intergenic
1033584109 7:142761561-142761583 TCTGGGTACCACTTCTGCAGTGG + Intronic
1035653831 8:1290347-1290369 TGTAGGCACCATTTGTAAAGCGG - Intergenic
1036632181 8:10523776-10523798 TCTGGGCTCCAGGTCTGATGAGG - Intergenic
1036667233 8:10755119-10755141 TGTGGGCTCCAGTCCTGACCTGG + Intronic
1041463036 8:58132437-58132459 TGTGGCCACAAGGACTGAAGAGG - Intronic
1041689179 8:60672581-60672603 TGGGGGCAACAGTTCTAAAGTGG - Intergenic
1043286384 8:78537065-78537087 TTTGGGGACCAGTTATGAAGGGG + Intronic
1049383609 8:142330045-142330067 TGTGGCCACCAGTTCTGCACAGG + Intronic
1050061758 9:1716864-1716886 TGAGGGCATCACTGCTGAAGGGG - Intergenic
1056435152 9:86568744-86568766 TGGGTGCATCAGTCCTGAAGAGG + Intergenic
1057501740 9:95601792-95601814 TGTGGGAGTCAGTGCTGAAGGGG + Intergenic
1059067017 9:111096077-111096099 TCTGGGAACCAGTGCAGAAGAGG - Intergenic
1059785181 9:117574346-117574368 TGTGGTCTCCATTTGTGAAGGGG + Intergenic
1061016927 9:127986737-127986759 TGTGGGCATCAGGGCTGCAGGGG - Intergenic
1202793581 9_KI270719v1_random:102465-102487 GATGGGCACCAGTTATCAAGTGG + Intergenic
1203571443 Un_KI270744v1:136106-136128 TGGGAGCACCAGCTCTGGAGAGG + Intergenic
1186813147 X:13209584-13209606 TGTGGGCAACAGTAAAGAAGGGG - Intergenic
1190683473 X:52849663-52849685 TGTGAGGTCCGGTTCTGAAGAGG - Intergenic
1191850203 X:65580729-65580751 TGTATGCTCCAGGTCTGAAGAGG + Intergenic
1192029849 X:67498091-67498113 TGTGGGTACATGTGCTGAAGTGG - Intergenic
1195968858 X:110453232-110453254 TGTGGGCATCATTTGTGATGTGG - Exonic
1198644456 X:138790530-138790552 TGTGGGAATCATTTCTGAGGTGG - Intronic
1200968169 Y:9120403-9120425 TGTGGCCCCCAGTACTGAGGAGG + Intergenic
1201149688 Y:11088860-11088882 GATGGGCACCAGTTATCAAGTGG - Intergenic