ID: 1127843350

View in Genome Browser
Species Human (GRCh38)
Location 15:62848707-62848729
Sequence AAGAAGACAGCTGTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127843350_1127843365 17 Left 1127843350 15:62848707-62848729 CCACCCACCACAGCTGTCTTCTT No data
Right 1127843365 15:62848747-62848769 CGTGGCCTTGCCATGCCACAGGG No data
1127843350_1127843364 16 Left 1127843350 15:62848707-62848729 CCACCCACCACAGCTGTCTTCTT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843350_1127843354 -1 Left 1127843350 15:62848707-62848729 CCACCCACCACAGCTGTCTTCTT No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127843350 Original CRISPR AAGAAGACAGCTGTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr