ID: 1127843354

View in Genome Browser
Species Human (GRCh38)
Location 15:62848729-62848751
Sequence TCCTCCTCCCCACCTCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127843346_1127843354 17 Left 1127843346 15:62848689-62848711 CCTGTTCCCAAACACCTACCACC No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843349_1127843354 3 Left 1127843349 15:62848703-62848725 CCTACCACCCACCACAGCTGTCT No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843348_1127843354 10 Left 1127843348 15:62848696-62848718 CCAAACACCTACCACCCACCACA No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843353_1127843354 -8 Left 1127843353 15:62848714-62848736 CCACAGCTGTCTTCTTCCTCCTC No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843352_1127843354 -5 Left 1127843352 15:62848711-62848733 CCACCACAGCTGTCTTCTTCCTC No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843351_1127843354 -4 Left 1127843351 15:62848710-62848732 CCCACCACAGCTGTCTTCTTCCT No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843350_1127843354 -1 Left 1127843350 15:62848707-62848729 CCACCCACCACAGCTGTCTTCTT No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data
1127843347_1127843354 11 Left 1127843347 15:62848695-62848717 CCCAAACACCTACCACCCACCAC No data
Right 1127843354 15:62848729-62848751 TCCTCCTCCCCACCTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127843354 Original CRISPR TCCTCCTCCCCACCTCCCCG TGG Intergenic
No off target data available for this crispr