ID: 1127843356

View in Genome Browser
Species Human (GRCh38)
Location 15:62848733-62848755
Sequence AAGGCCACGGGGAGGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127843356_1127843364 -10 Left 1127843356 15:62848733-62848755 CCTCCCCACCTCCCCGTGGCCTT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843356_1127843365 -9 Left 1127843356 15:62848733-62848755 CCTCCCCACCTCCCCGTGGCCTT No data
Right 1127843365 15:62848747-62848769 CGTGGCCTTGCCATGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127843356 Original CRISPR AAGGCCACGGGGAGGTGGGG AGG (reversed) Intergenic
No off target data available for this crispr