ID: 1127843364

View in Genome Browser
Species Human (GRCh38)
Location 15:62848746-62848768
Sequence CCGTGGCCTTGCCATGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127843350_1127843364 16 Left 1127843350 15:62848707-62848729 CCACCCACCACAGCTGTCTTCTT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843355_1127843364 -7 Left 1127843355 15:62848730-62848752 CCTCCTCCCCACCTCCCCGTGGC No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843356_1127843364 -10 Left 1127843356 15:62848733-62848755 CCTCCCCACCTCCCCGTGGCCTT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843353_1127843364 9 Left 1127843353 15:62848714-62848736 CCACAGCTGTCTTCTTCCTCCTC No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843348_1127843364 27 Left 1127843348 15:62848696-62848718 CCAAACACCTACCACCCACCACA No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843349_1127843364 20 Left 1127843349 15:62848703-62848725 CCTACCACCCACCACAGCTGTCT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843352_1127843364 12 Left 1127843352 15:62848711-62848733 CCACCACAGCTGTCTTCTTCCTC No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843351_1127843364 13 Left 1127843351 15:62848710-62848732 CCCACCACAGCTGTCTTCTTCCT No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data
1127843347_1127843364 28 Left 1127843347 15:62848695-62848717 CCCAAACACCTACCACCCACCAC No data
Right 1127843364 15:62848746-62848768 CCGTGGCCTTGCCATGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127843364 Original CRISPR CCGTGGCCTTGCCATGCCAC AGG Intergenic
No off target data available for this crispr