ID: 1127845712

View in Genome Browser
Species Human (GRCh38)
Location 15:62868763-62868785
Sequence CCAAATAAGGAGTTGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127845712_1127845718 14 Left 1127845712 15:62868763-62868785 CCGGCCTCCAACTCCTTATTTGG No data
Right 1127845718 15:62868800-62868822 ATGAAGTTGACAGCATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127845712 Original CRISPR CCAAATAAGGAGTTGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr