ID: 1127848455

View in Genome Browser
Species Human (GRCh38)
Location 15:62891972-62891994
Sequence GCATCCTTAAGAAATTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127848449_1127848455 6 Left 1127848449 15:62891943-62891965 CCCAAGAACTAGTGCCCAAGAGC No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848448_1127848455 9 Left 1127848448 15:62891940-62891962 CCTCCCAAGAACTAGTGCCCAAG No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848446_1127848455 15 Left 1127848446 15:62891934-62891956 CCAAGCCCTCCCAAGAACTAGTG No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848451_1127848455 -8 Left 1127848451 15:62891957-62891979 CCCAAGAGCTGCCCAGCATCCTT No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848452_1127848455 -9 Left 1127848452 15:62891958-62891980 CCAAGAGCTGCCCAGCATCCTTA No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848450_1127848455 5 Left 1127848450 15:62891944-62891966 CCAAGAACTAGTGCCCAAGAGCT No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848447_1127848455 10 Left 1127848447 15:62891939-62891961 CCCTCCCAAGAACTAGTGCCCAA No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data
1127848445_1127848455 30 Left 1127848445 15:62891919-62891941 CCTCTGATGACAGAACCAAGCCC No data
Right 1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127848455 Original CRISPR GCATCCTTAAGAAATTGTAT TGG Intergenic
No off target data available for this crispr