ID: 1127852307

View in Genome Browser
Species Human (GRCh38)
Location 15:62924541-62924563
Sequence GTCCTAAGTAGACTATTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127852307_1127852311 -10 Left 1127852307 15:62924541-62924563 CCCCCTAATAGTCTACTTAGGAC No data
Right 1127852311 15:62924554-62924576 TACTTAGGACTTCTCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127852307 Original CRISPR GTCCTAAGTAGACTATTAGG GGG (reversed) Intergenic
No off target data available for this crispr