ID: 1127852316

View in Genome Browser
Species Human (GRCh38)
Location 15:62924610-62924632
Sequence GTTTGCTCCAAGGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127852316_1127852322 -2 Left 1127852316 15:62924610-62924632 CCTTCCCTCTCCTTGGAGCAAAC No data
Right 1127852322 15:62924631-62924653 ACAGAAAGGGAAGCACAGCCAGG No data
1127852316_1127852325 17 Left 1127852316 15:62924610-62924632 CCTTCCCTCTCCTTGGAGCAAAC No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data
1127852316_1127852324 16 Left 1127852316 15:62924610-62924632 CCTTCCCTCTCCTTGGAGCAAAC No data
Right 1127852324 15:62924649-62924671 CCAGGCTGTTTCCCGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127852316 Original CRISPR GTTTGCTCCAAGGAGAGGGA AGG (reversed) Intergenic