ID: 1127852317

View in Genome Browser
Species Human (GRCh38)
Location 15:62924614-62924636
Sequence TTCTGTTTGCTCCAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127852317_1127852328 30 Left 1127852317 15:62924614-62924636 CCCTCTCCTTGGAGCAAACAGAA No data
Right 1127852328 15:62924667-62924689 TCAGGGCCTAGCACAGCACCTGG No data
1127852317_1127852324 12 Left 1127852317 15:62924614-62924636 CCCTCTCCTTGGAGCAAACAGAA No data
Right 1127852324 15:62924649-62924671 CCAGGCTGTTTCCCGTTCTCAGG No data
1127852317_1127852322 -6 Left 1127852317 15:62924614-62924636 CCCTCTCCTTGGAGCAAACAGAA No data
Right 1127852322 15:62924631-62924653 ACAGAAAGGGAAGCACAGCCAGG No data
1127852317_1127852325 13 Left 1127852317 15:62924614-62924636 CCCTCTCCTTGGAGCAAACAGAA No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127852317 Original CRISPR TTCTGTTTGCTCCAAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr