ID: 1127852318

View in Genome Browser
Species Human (GRCh38)
Location 15:62924615-62924637
Sequence TTTCTGTTTGCTCCAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127852318_1127852328 29 Left 1127852318 15:62924615-62924637 CCTCTCCTTGGAGCAAACAGAAA No data
Right 1127852328 15:62924667-62924689 TCAGGGCCTAGCACAGCACCTGG No data
1127852318_1127852322 -7 Left 1127852318 15:62924615-62924637 CCTCTCCTTGGAGCAAACAGAAA No data
Right 1127852322 15:62924631-62924653 ACAGAAAGGGAAGCACAGCCAGG No data
1127852318_1127852324 11 Left 1127852318 15:62924615-62924637 CCTCTCCTTGGAGCAAACAGAAA No data
Right 1127852324 15:62924649-62924671 CCAGGCTGTTTCCCGTTCTCAGG No data
1127852318_1127852325 12 Left 1127852318 15:62924615-62924637 CCTCTCCTTGGAGCAAACAGAAA No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127852318 Original CRISPR TTTCTGTTTGCTCCAAGGAG AGG (reversed) Intergenic