ID: 1127852325

View in Genome Browser
Species Human (GRCh38)
Location 15:62924650-62924672
Sequence CAGGCTGTTTCCCGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127852318_1127852325 12 Left 1127852318 15:62924615-62924637 CCTCTCCTTGGAGCAAACAGAAA No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data
1127852316_1127852325 17 Left 1127852316 15:62924610-62924632 CCTTCCCTCTCCTTGGAGCAAAC No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data
1127852321_1127852325 7 Left 1127852321 15:62924620-62924642 CCTTGGAGCAAACAGAAAGGGAA No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data
1127852317_1127852325 13 Left 1127852317 15:62924614-62924636 CCCTCTCCTTGGAGCAAACAGAA No data
Right 1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127852325 Original CRISPR CAGGCTGTTTCCCGTTCTCA GGG Intergenic
No off target data available for this crispr