ID: 1127854271

View in Genome Browser
Species Human (GRCh38)
Location 15:62941726-62941748
Sequence TTGGTAAGACAGACCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127854266_1127854271 6 Left 1127854266 15:62941697-62941719 CCTGGAAGGGTATTGAATGATAC No data
Right 1127854271 15:62941726-62941748 TTGGTAAGACAGACCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127854271 Original CRISPR TTGGTAAGACAGACCTGGCA GGG Intergenic
No off target data available for this crispr