ID: 1127854653

View in Genome Browser
Species Human (GRCh38)
Location 15:62944603-62944625
Sequence TGTAATCTCCGCACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127854650_1127854653 -3 Left 1127854650 15:62944583-62944605 CCAGGTGCGTGGCTCATGCCTGT No data
Right 1127854653 15:62944603-62944625 TGTAATCTCCGCACTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127854653 Original CRISPR TGTAATCTCCGCACTTCAGG AGG Intergenic
No off target data available for this crispr