ID: 1127856994

View in Genome Browser
Species Human (GRCh38)
Location 15:62961242-62961264
Sequence CTGGCCCGTCCAGCACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127856994_1127856995 -6 Left 1127856994 15:62961242-62961264 CCAGCGGGTGCTGGACGGGCCAG No data
Right 1127856995 15:62961259-62961281 GGCCAGCCTCGTGATGCCTCCGG No data
1127856994_1127856999 10 Left 1127856994 15:62961242-62961264 CCAGCGGGTGCTGGACGGGCCAG No data
Right 1127856999 15:62961275-62961297 CCTCCGGTTTTACAAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127856994 Original CRISPR CTGGCCCGTCCAGCACCCGC TGG (reversed) Intergenic
No off target data available for this crispr