ID: 1127857895

View in Genome Browser
Species Human (GRCh38)
Location 15:62967558-62967580
Sequence AATTGGGTAAGGTGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127857895_1127857903 7 Left 1127857895 15:62967558-62967580 CCTTCCTCCCACCTTACCCAATT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127857895 Original CRISPR AATTGGGTAAGGTGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr