ID: 1127857903

View in Genome Browser
Species Human (GRCh38)
Location 15:62967588-62967610
Sequence ACTGAAAGACACAGCAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127857901_1127857903 -10 Left 1127857901 15:62967575-62967597 CCAATTATCTCCTACTGAAAGAC No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857897_1127857903 0 Left 1127857897 15:62967565-62967587 CCCACCTTACCCAATTATCTCCT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857900_1127857903 -9 Left 1127857900 15:62967574-62967596 CCCAATTATCTCCTACTGAAAGA No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857898_1127857903 -1 Left 1127857898 15:62967566-62967588 CCACCTTACCCAATTATCTCCTA No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857893_1127857903 27 Left 1127857893 15:62967538-62967560 CCTTGTTAGGTGTGCAAGGCCCT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857895_1127857903 7 Left 1127857895 15:62967558-62967580 CCTTCCTCCCACCTTACCCAATT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857894_1127857903 8 Left 1127857894 15:62967557-62967579 CCCTTCCTCCCACCTTACCCAAT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857899_1127857903 -4 Left 1127857899 15:62967569-62967591 CCTTACCCAATTATCTCCTACTG No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data
1127857896_1127857903 3 Left 1127857896 15:62967562-62967584 CCTCCCACCTTACCCAATTATCT No data
Right 1127857903 15:62967588-62967610 ACTGAAAGACACAGCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127857903 Original CRISPR ACTGAAAGACACAGCAACCC AGG Intergenic
No off target data available for this crispr