ID: 1127861108

View in Genome Browser
Species Human (GRCh38)
Location 15:62994882-62994904
Sequence CCCGGGCAAATGGTGTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127861103_1127861108 -9 Left 1127861103 15:62994868-62994890 CCTTCAAAAGTCTACCCGGGCAA No data
Right 1127861108 15:62994882-62994904 CCCGGGCAAATGGTGTTAAGGGG No data
1127861100_1127861108 -1 Left 1127861100 15:62994860-62994882 CCTGAAGTCCTTCAAAAGTCTAC No data
Right 1127861108 15:62994882-62994904 CCCGGGCAAATGGTGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127861108 Original CRISPR CCCGGGCAAATGGTGTTAAG GGG Intergenic
No off target data available for this crispr