ID: 1127861111

View in Genome Browser
Species Human (GRCh38)
Location 15:62994908-62994930
Sequence GCTGAACTCCACAAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127861111_1127861121 16 Left 1127861111 15:62994908-62994930 CCCTTCCCTTTGTGGAGTTCAGC No data
Right 1127861121 15:62994947-62994969 CACATCCTTGGTGCTTTCCTAGG No data
1127861111_1127861124 23 Left 1127861111 15:62994908-62994930 CCCTTCCCTTTGTGGAGTTCAGC No data
Right 1127861124 15:62994954-62994976 TTGGTGCTTTCCTAGGAAGGAGG No data
1127861111_1127861116 4 Left 1127861111 15:62994908-62994930 CCCTTCCCTTTGTGGAGTTCAGC No data
Right 1127861116 15:62994935-62994957 TCTGCCCCACACCACATCCTTGG No data
1127861111_1127861122 20 Left 1127861111 15:62994908-62994930 CCCTTCCCTTTGTGGAGTTCAGC No data
Right 1127861122 15:62994951-62994973 TCCTTGGTGCTTTCCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127861111 Original CRISPR GCTGAACTCCACAAAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr