ID: 1127867863

View in Genome Browser
Species Human (GRCh38)
Location 15:63046645-63046667
Sequence TCGAAGACTCCATTTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127867858_1127867863 8 Left 1127867858 15:63046614-63046636 CCACCTAAGTCAAAAGTGAGGCT 0: 1
1: 0
2: 0
3: 2
4: 96
Right 1127867863 15:63046645-63046667 TCGAAGACTCCATTTTTTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 155
1127867859_1127867863 5 Left 1127867859 15:63046617-63046639 CCTAAGTCAAAAGTGAGGCTGAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 1127867863 15:63046645-63046667 TCGAAGACTCCATTTTTTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127867863 Original CRISPR TCGAAGACTCCATTTTTTTC TGG Intronic
902249960 1:15147861-15147883 TCAAAGCCTCCATTTGGTTCAGG + Intergenic
909058392 1:70849802-70849824 TCGAAGAATAAATTTTTTACAGG - Intergenic
909505352 1:76382147-76382169 TAGAGGATTCCACTTTTTTCTGG - Intronic
909692924 1:78430455-78430477 TAGAAGAAGCCATTTTTTGCAGG - Intronic
912051853 1:105539786-105539808 TTGAAGACTAAATTTTTTGCAGG + Intergenic
917487258 1:175466566-175466588 TCGATGGCCACATTTTTTTCTGG + Intronic
917929910 1:179815971-179815993 TCTGAGACTCCATTTTCTCCAGG + Exonic
918684066 1:187393252-187393274 TTTAAGGCTTCATTTTTTTCAGG - Intergenic
919316951 1:195982933-195982955 TAGAAGACTCTCTTTTTTGCTGG + Intergenic
920144267 1:203844661-203844683 TGGGAGACTCCATTTATGTCTGG + Intronic
920157301 1:203964674-203964696 TCAAAGATGCCATTTTCTTCTGG + Intergenic
921564444 1:216699491-216699513 AAGAAAATTCCATTTTTTTCTGG - Intronic
922216146 1:223521854-223521876 TCTAATACTTCATTTTTTCCAGG + Intergenic
924066380 1:240226912-240226934 TTGAAGACTGGATGTTTTTCAGG + Intronic
924144184 1:241057047-241057069 TCCAAGACTTTTTTTTTTTCTGG + Intronic
1063238876 10:4147767-4147789 TTGAAGACCCCACTTCTTTCGGG - Intergenic
1065072997 10:22047220-22047242 TCAAAGATTCCATTTGTTGCCGG - Intergenic
1066090530 10:32014433-32014455 TCGGAGCCTGCTTTTTTTTCCGG - Intronic
1067487576 10:46665476-46665498 GCTAAGACTCCATTTTTTTCTGG + Intergenic
1067607230 10:47676531-47676553 GCTAAGACTCCATTTTTTTCTGG - Intergenic
1071622786 10:87137911-87137933 GCTAAGACTCCATTTTTTTCTGG - Intronic
1076025295 10:127107219-127107241 GTGAAGACACCATTTTTTACCGG + Intronic
1076180884 10:128406249-128406271 TCTCAGATTCCATTTTTTTAGGG + Intergenic
1077800508 11:5531483-5531505 TCTAAAGCTCCATTTCTTTCTGG + Intronic
1079313322 11:19386364-19386386 TCTAAGACTCTGTTTTTTCCTGG + Intronic
1079352219 11:19701247-19701269 TCCACGACCCCATTTTCTTCTGG - Intronic
1080160191 11:29164950-29164972 TCTCAGACTCCATTTGTTTTTGG - Intergenic
1082699065 11:56405199-56405221 TGGAAGTCACCATATTTTTCTGG - Intergenic
1085959278 11:81440720-81440742 ACGATCACTCCATTTCTTTCTGG + Intergenic
1087337425 11:96862366-96862388 TATAAGACTCCAATCTTTTCTGG + Intergenic
1088732901 11:112699109-112699131 TCGAAGAATTCATTTTCTTCAGG + Intergenic
1095492417 12:42748524-42748546 TCTAACAATCCTTTTTTTTCTGG - Intergenic
1098375110 12:69806945-69806967 TAGGAGACTCCATTTTGTTCTGG - Intronic
1098732137 12:74049956-74049978 TCAAAGCCTCCAATTTATTCTGG - Intergenic
1100136670 12:91561292-91561314 TAGAAAACTCTTTTTTTTTCTGG + Intergenic
1100903248 12:99267762-99267784 TCCAAGGCTCCATCTTTTTCTGG - Intronic
1101504368 12:105331988-105332010 TCTTAAACTCCATTTTTTACCGG - Intronic
1101600022 12:106201311-106201333 CTGAAGACTCTATTCTTTTCTGG + Intergenic
1105827442 13:24134947-24134969 TCTAAGTCTCCACTTTTTTAAGG - Intronic
1107183162 13:37485776-37485798 TCCAACACAACATTTTTTTCTGG - Intergenic
1108487119 13:50938308-50938330 TGGAAGACTCAATATTTTTAAGG + Intronic
1109170365 13:59088721-59088743 CCAAGGCCTCCATTTTTTTCTGG - Intergenic
1109880983 13:68476090-68476112 CCAAGGACTCCCTTTTTTTCTGG - Intergenic
1111011135 13:82316704-82316726 GCTATGACTCCATTTCTTTCTGG + Intergenic
1113741185 13:112713635-112713657 TCTGAGACTCCATTTGTTTCAGG + Intronic
1116748459 14:48851098-48851120 TCCAAGACATCATTCTTTTCTGG - Intergenic
1118080479 14:62353199-62353221 CTAAAGACTCCATTTTTTTTCGG - Intergenic
1120000030 14:79292369-79292391 TCTAAGAATCCGTTTTTTTCAGG + Intronic
1120304324 14:82748448-82748470 TCTTAAACTCCATTTTATTCAGG - Intergenic
1120949206 14:90025609-90025631 TCAAAGACTTTATTCTTTTCAGG + Intronic
1125343907 15:38699688-38699710 TCCATAACTCCATTTTCTTCAGG + Exonic
1127247895 15:57197711-57197733 TTGAAGTCTTGATTTTTTTCTGG + Intronic
1127867863 15:63046645-63046667 TCGAAGACTCCATTTTTTTCTGG + Intronic
1128596509 15:68956560-68956582 GCTAAGACTCTATTTTTTTGGGG + Intronic
1133690300 16:8207914-8207936 TTGGAGCCTCCATTTTATTCTGG - Intergenic
1135973744 16:27091304-27091326 GTGAAGACTCCATTTCTTTGTGG - Intergenic
1137345929 16:47659714-47659736 GACAAGTCTCCATTTTTTTCAGG - Intronic
1137585392 16:49661263-49661285 TGGGAGTCTCCATATTTTTCCGG + Intronic
1138065866 16:53940812-53940834 TCTAAGTTCCCATTTTTTTCTGG + Intronic
1140586210 16:76295255-76295277 TCAAAGACTCCATGCTTTTGTGG - Intronic
1140918441 16:79514747-79514769 TCAGGGACTCCATTGTTTTCTGG + Intergenic
1145391416 17:22458856-22458878 TCCCAGACTCCATTGTCTTCAGG + Intergenic
1145823188 17:27856343-27856365 TAGAAGTCTTCATTTTTTTATGG - Intronic
1148506745 17:48133311-48133333 TCCAAGTCTCCTTTTTTCTCTGG + Intergenic
1149907106 17:60536494-60536516 TCTTAGACTCCATAATTTTCAGG + Intergenic
1150370313 17:64631941-64631963 TCTAAGACTCTCTTTTTTTGCGG + Intronic
1150420701 17:65032788-65032810 TCTATGACTTCATTTTTCTCTGG + Intronic
1156721195 18:40071836-40071858 TTGCTGACTCCATTTTCTTCTGG + Intergenic
1156900205 18:42291718-42291740 TCCAAAATTCCATTTTTATCAGG - Intergenic
1159324298 18:66894547-66894569 TAGGAGACTCCATTTTGTTCTGG + Intergenic
1162297297 19:9822033-9822055 TCGAAGGCCCCAGTTTTTCCAGG - Intronic
1163621247 19:18361897-18361919 GCGAGTTCTCCATTTTTTTCTGG + Intronic
1163742547 19:19024776-19024798 TCGAAGACTCCACTTTGTTTGGG - Exonic
1167245998 19:48373561-48373583 GCGGAGACTCCATCTTGTTCTGG - Exonic
1167878768 19:52437055-52437077 GGGAACACTCCATTCTTTTCTGG + Intronic
1168483372 19:56740146-56740168 TGAAAGACTCCATTTTTATTTGG + Intergenic
926789022 2:16551249-16551271 TATAAGACTCCATTGCTTTCTGG - Exonic
927351974 2:22126299-22126321 TCCAAGACTCCAATTCTTTGGGG - Intergenic
927381710 2:22487083-22487105 TCGAAGACTCTAGTTTGTTAAGG - Intergenic
928800041 2:35078365-35078387 TTTAAAACTCCATTATTTTCTGG + Intergenic
930105022 2:47632780-47632802 TCGCAAACTCCATTTTCTACAGG + Intergenic
930730170 2:54721754-54721776 TCAATGACTCCATTATTTTAAGG + Intergenic
931391028 2:61844142-61844164 TTGAAGACTGCTTTTTTTTTTGG - Intronic
931585238 2:63819220-63819242 TCTAAGCCTCAATTTTTATCAGG + Intronic
933429451 2:82156916-82156938 TGGAAGACTACTTTGTTTTCAGG - Intergenic
936589379 2:113788640-113788662 TCCCTTACTCCATTTTTTTCAGG - Intergenic
936863452 2:117050557-117050579 TGCAAGGCTGCATTTTTTTCTGG + Intergenic
946086586 2:217179527-217179549 TGGCAGACTGCATTATTTTCTGG - Intergenic
1169113620 20:3048509-3048531 GAGGAGACCCCATTTTTTTCTGG + Intergenic
1172897656 20:38311892-38311914 GCGCAGACTCAATTTTTTTGTGG - Exonic
1174697541 20:52575286-52575308 TAGTAGACTTTATTTTTTTCAGG - Intergenic
1174728049 20:52885668-52885690 TCTGAGACTCCATATTATTCTGG + Intergenic
1177326891 21:19602218-19602240 TCAAAGACGCCATCTTCTTCTGG + Intergenic
953322205 3:41982967-41982989 TAGGAGACTCCATTTTGATCTGG - Intergenic
956668541 3:71664377-71664399 TCAATGCCTCCATTTTTTTTTGG + Intergenic
957179690 3:76860525-76860547 TAGTTGACTCCATTGTTTTCAGG + Intronic
960038467 3:113125414-113125436 TGGAAGATTCCATTATTATCAGG + Intergenic
961207312 3:125095027-125095049 TGGAATACTCCAATATTTTCAGG - Intronic
962652064 3:137506176-137506198 TTGAACAGCCCATTTTTTTCTGG - Intergenic
962655366 3:137538738-137538760 TCAAGGACTCAATTTCTTTCTGG + Intergenic
964635772 3:158857510-158857532 TCAAAGACTTCATTTTGTTTTGG + Intergenic
965759805 3:172063692-172063714 TTAGAGACTCTATTTTTTTCAGG - Intronic
965838546 3:172878023-172878045 TTGAAGAGTCCATTTCTCTCTGG + Intergenic
966588459 3:181653215-181653237 TCCAAGACCCCACTCTTTTCTGG - Intergenic
968712968 4:2133701-2133723 TTTAAGACTCCATTTGTTTCAGG + Intronic
970241900 4:14017924-14017946 TCAAAGAGTCCATTTCTTTTTGG - Intergenic
971523492 4:27585777-27585799 TTGAAGACTCTCTTTCTTTCAGG - Intergenic
971670755 4:29553728-29553750 TCTCAGATTTCATTTTTTTCTGG + Intergenic
971973934 4:33659081-33659103 TGGAAAAGTCCATGTTTTTCAGG + Intergenic
972992307 4:44835560-44835582 TCAAAGATTTGATTTTTTTCAGG - Intergenic
973048111 4:45561421-45561443 TCGAAGTTTTCATTTCTTTCTGG + Intergenic
975437424 4:74369080-74369102 TTAAAAAATCCATTTTTTTCTGG - Intronic
978068365 4:104434687-104434709 TCTAATACTCTATTTTCTTCAGG + Intergenic
979452665 4:120891227-120891249 TCAAAGATTCCATTTCTTCCTGG + Intronic
980542862 4:134217106-134217128 GACAAGACTGCATTTTTTTCTGG - Intergenic
981134356 4:141193013-141193035 TCTAAAACTCCATTTCCTTCTGG + Intronic
981269874 4:142833073-142833095 TGGAAGACTCAAGTTTTTTTAGG + Intronic
981303561 4:143219949-143219971 AAGAAGACTGAATTTTTTTCTGG - Intronic
982589624 4:157290467-157290489 TCAAAAACTCCATTCTTGTCTGG + Intronic
983367969 4:166819739-166819761 TGGAAGACTCTTTTTTTTTTTGG + Intronic
983658420 4:170107004-170107026 TCCAAGACTCCAATTCTTTGGGG - Intergenic
984832331 4:183987179-183987201 TCTCTGACTCCATTTTTCTCGGG + Intronic
987726954 5:21715792-21715814 TCGAAGACTTCCTATTCTTCTGG + Intergenic
988177514 5:27745346-27745368 TCAAATACTGGATTTTTTTCTGG - Intergenic
988564162 5:32307641-32307663 TAGAAGAATCCATTTTACTCTGG + Intronic
992957213 5:81922375-81922397 TCGCAGACCCCATTTCTTTTGGG - Intergenic
995246762 5:109944179-109944201 CAGAGGACTTCATTTTTTTCAGG - Intergenic
995382359 5:111549271-111549293 TTGTAGACACCATTTTTTCCTGG + Intergenic
995654246 5:114406975-114406997 TTGAAGTATCCATTTTCTTCTGG + Intronic
996953900 5:129160743-129160765 TCAAAGATTCCATTTCTTCCTGG + Intergenic
1005192538 6:23242414-23242436 TCCTAGAATTCATTTTTTTCAGG + Intergenic
1007955086 6:45910891-45910913 TCAGAGTCTCCATTTATTTCTGG + Intronic
1008292425 6:49733640-49733662 TTGAAGAATCCTTTTTTTTTAGG + Intronic
1014424163 6:121283402-121283424 TCCAAAACTCCAATCTTTTCAGG - Intronic
1015302295 6:131667554-131667576 TCTAACACTCCAATTTTTCCAGG - Intronic
1017274634 6:152552001-152552023 TTCAAGACTCCCTTTCTTTCTGG - Intronic
1019389441 7:777696-777718 CCGATGACTCCATTCATTTCCGG - Intronic
1021034514 7:15781517-15781539 TCAGAGACTTAATTTTTTTCTGG + Intergenic
1023229822 7:38015219-38015241 TGGAAGACTCAATATTTTTAAGG - Intronic
1023406405 7:39837916-39837938 TTGCATACTCCATTATTTTCTGG - Intergenic
1026383918 7:69826810-69826832 TGGAAGACTACATTTTTCTGGGG + Intronic
1026573593 7:71553781-71553803 TTGAAAACTCCATCTCTTTCAGG + Intronic
1030848657 7:114455476-114455498 TGGAAAACTCTATTTTTTACTGG - Intronic
1036449471 8:8853213-8853235 TTTAAGCCTCCATTTTTTTTGGG - Intronic
1040010393 8:42656745-42656767 CCCAAGACTTCATTTTCTTCTGG + Intergenic
1040669759 8:49675648-49675670 TTGAATACTCCATTTATTTATGG - Intergenic
1041888262 8:62838844-62838866 TAGAAGAGTCCAAGTTTTTCTGG - Intronic
1043376708 8:79657616-79657638 TCTAGGACCACATTTTTTTCTGG + Intronic
1043431967 8:80204053-80204075 TGGAAGACCCCATTTTTCTCAGG - Intronic
1044419374 8:91975626-91975648 TATAAAACTCCATTTTTTTCAGG - Intronic
1047014984 8:120714447-120714469 TCCATGATTCCATTTCTTTCTGG - Intronic
1048883766 8:138892221-138892243 ATGAACACTCCATTTATTTCTGG - Intronic
1050259075 9:3822066-3822088 TGGGAGACTTCATTTTTCTCGGG - Intergenic
1051720813 9:20035416-20035438 TGGAAGTCTCCACTTTTTTCAGG - Intergenic
1051776165 9:20636514-20636536 TGGAAGACACGGTTTTTTTCTGG - Intergenic
1052114786 9:24637271-24637293 TCAGGGACTCCATTTCTTTCTGG + Intergenic
1055074957 9:72204733-72204755 TCAAAGACTATATATTTTTCAGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1186308706 X:8293340-8293362 TCGGAGACTCTATATCTTTCTGG - Intergenic
1186342233 X:8657222-8657244 GCGAAGCTTCCATTGTTTTCAGG - Intronic
1187520958 X:20013450-20013472 AGGAAAACTGCATTTTTTTCTGG + Intronic
1188363288 X:29283151-29283173 AAGAAGACTCCATTTGGTTCCGG + Exonic
1189172325 X:38921429-38921451 TTGATGACTTCATTTTTTTTAGG + Intergenic
1190808214 X:53860208-53860230 ACGGAGACTCCATTTATTTGGGG - Intergenic
1192252811 X:69427176-69427198 TCAAAAACTTCATTTTTTTAAGG + Intergenic
1193753643 X:85379306-85379328 TCATACACTACATTTTTTTCTGG + Exonic
1194211563 X:91076354-91076376 TCCCAGACACCATTCTTTTCAGG + Intergenic
1197337651 X:125227313-125227335 TCTAATACTCCACTTTTTTGTGG - Intergenic
1197371414 X:125630131-125630153 ACTAGGACTCCATTTTTATCTGG - Intergenic
1200623284 Y:5480566-5480588 TGGGAGAATCCCTTTTTTTCAGG + Intronic
1200965315 Y:9030255-9030277 TAGAAGACTCCAGTATTTTCTGG + Intergenic