ID: 1127869560

View in Genome Browser
Species Human (GRCh38)
Location 15:63059939-63059961
Sequence CCGGACAAAAGATCTTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127869553_1127869560 -7 Left 1127869553 15:63059923-63059945 CCCCAGCCACAAAGACCCGGACA 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1127869549_1127869560 7 Left 1127869549 15:63059909-63059931 CCAAAACTCCTCTCCCCCAGCCA 0: 1
1: 1
2: 2
3: 47
4: 525
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1127869555_1127869560 -9 Left 1127869555 15:63059925-63059947 CCAGCCACAAAGACCCGGACAAA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1127869552_1127869560 -6 Left 1127869552 15:63059922-63059944 CCCCCAGCCACAAAGACCCGGAC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1127869554_1127869560 -8 Left 1127869554 15:63059924-63059946 CCCAGCCACAAAGACCCGGACAA 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1127869550_1127869560 -1 Left 1127869550 15:63059917-63059939 CCTCTCCCCCAGCCACAAAGACC 0: 1
1: 0
2: 3
3: 56
4: 612
Right 1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127869560 Original CRISPR CCGGACAAAAGATCTTTGGC CGG Intronic
912271144 1:108209897-108209919 CCCCACAAAAGATCTCTGGGAGG + Intergenic
919747735 1:201019304-201019326 ACGGACATAAAATCTTTGGAGGG - Intronic
919790420 1:201286825-201286847 CCCAGCAAAAGATCTTTGCCAGG + Intronic
1063474036 10:6312598-6312620 CCAGAAAAAAGATCTCTGGTTGG + Intergenic
1063991906 10:11575391-11575413 CTGGAGAGAAGATCTTTGGAAGG + Intronic
1064235725 10:13572847-13572869 CCGTAAAAAATATCTTAGGCTGG - Intergenic
1068627388 10:59264055-59264077 GAGGAAAAAAGATCTTTGGCTGG + Intronic
1072375630 10:94813271-94813293 TCATACAAAAGAGCTTTGGCTGG - Intronic
1072389500 10:94968918-94968940 TCATACAAAAGAGCTTTGGCTGG - Intronic
1087353880 11:97069567-97069589 CTGGATATAAGATCTTTGTCAGG + Intergenic
1089156349 11:116405861-116405883 CTGGACAAAAGATCAGTGGGAGG + Intergenic
1096161541 12:49382402-49382424 CAGCACAAAATATCTTTGGAAGG - Intronic
1098789602 12:74804938-74804960 CTGGACATTAGATCTTTGTCAGG - Intergenic
1111671621 13:91338544-91338566 CCGGACAAAGTATTCTTGGCTGG + Intergenic
1118951631 14:70440971-70440993 CCTGACAAGAGCTCTTTTGCTGG - Intergenic
1122182311 14:99964929-99964951 CCGGACCAACCATCTATGGCTGG + Intergenic
1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG + Intronic
1143274159 17:5697610-5697632 CCGGACAAAAGGGCTGTGGCAGG - Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1153472677 18:5464377-5464399 CCTGACCACAGATCTTTGGCTGG - Intronic
1161991807 19:7688651-7688673 TGGGACATCAGATCTTTGGCCGG - Intergenic
926655320 2:15397830-15397852 CCAAACAAAAAATCTTTGCCTGG + Intronic
929427161 2:41855128-41855150 CCTGACAGCAGATCTTGGGCTGG + Intergenic
929900136 2:45993541-45993563 CCTGACAAAACAACTTGGGCTGG - Intronic
930539177 2:52682799-52682821 CTGGACACAATATCTTTGGCTGG - Intergenic
930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG + Intronic
935583672 2:104782200-104782222 GTGGACAAAAGAACTTAGGCAGG + Intergenic
942359106 2:175153523-175153545 CAGTACAAAAGATTTTAGGCTGG + Intronic
943898550 2:193401682-193401704 CTGGACATTAGATCTTTGTCAGG + Intergenic
1169475285 20:5925656-5925678 CCTGAAAAATGAACTTTGGCTGG - Intergenic
1169987944 20:11467865-11467887 CTGGACAGAAAATTTTTGGCTGG + Intergenic
1170317768 20:15061273-15061295 CCTGACAAAAGCCCTTAGGCAGG - Intronic
1171409586 20:24936993-24937015 CGGGACAACAGATCTTGTGCAGG + Intergenic
952418328 3:33109275-33109297 CTGGGCAAAGGCTCTTTGGCAGG + Intergenic
968471297 4:783578-783600 CCACACAAAAAATCTTTGTCAGG - Intergenic
969013212 4:4084431-4084453 CCGGAGAAAAGATACTAGGCTGG - Intergenic
975867947 4:78744990-78745012 CAGGCCATATGATCTTTGGCAGG + Intergenic
985834234 5:2258970-2258992 CCGGATAAAAGTTCTGTGGTGGG + Intergenic
986699931 5:10396553-10396575 TTAGACAAAAGATCTTTGGACGG + Intronic
986829661 5:11561743-11561765 CCTGAAAAGAGATCTTTGGCTGG + Intronic
999798424 5:155009633-155009655 CCGGAACAAGCATCTTTGGCAGG + Intergenic
1000468995 5:161615620-161615642 CAGTATAAAAGATCTTTGGACGG + Intronic
1001320518 5:170676922-170676944 CTGGAAGAAAGATCTGTGGCTGG + Intronic
1003396930 6:5761493-5761515 CAGAACAGAAGATCTGTGGCAGG - Intronic
1004988368 6:21108409-21108431 AAGGACAAAAGATCTTTCTCGGG + Exonic
1008663591 6:53694477-53694499 CCTTACAAAGGATCTTTGGAAGG + Intergenic
1014687619 6:124522845-124522867 AAGAAAAAAAGATCTTTGGCCGG + Intronic
1019345470 7:527797-527819 CAGGGCTAAACATCTTTGGCAGG - Intergenic
1034677833 7:152904144-152904166 CCAGGCAGGAGATCTTTGGCAGG + Intergenic
1037937959 8:22927889-22927911 CCGGACACAAGTACTTTGGGAGG + Exonic
1041342653 8:56862421-56862443 TCGCACAGAAAATCTTTGGCAGG + Intergenic
1041773887 8:61503064-61503086 GTGGAAAAAATATCTTTGGCTGG + Exonic
1052693300 9:31844173-31844195 AAGCACAAAAGATATTTGGCAGG + Intergenic
1056067602 9:82953353-82953375 CCTGACAAAAGGTCTTTGGAGGG + Intergenic
1059068354 9:111108618-111108640 CCTGACAAAGGATGTTTGGATGG + Intergenic
1199269891 X:145871269-145871291 CCGGACATAAAATTCTTGGCTGG + Intergenic