ID: 1127869902

View in Genome Browser
Species Human (GRCh38)
Location 15:63063107-63063129
Sequence CTTTATATCCTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127869902 Original CRISPR CTTTATATCCTGAAGGAGGA GGG Intronic
901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG + Intronic
901689195 1:10961394-10961416 CTTCTTAACCTGAAGGAGCAGGG - Intronic
902227219 1:15003986-15004008 CTTTAAAGCCTGGAGAAGGAAGG - Intronic
904597011 1:31653220-31653242 CTATATAGCCTGAAAGAGGATGG - Intronic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
906318769 1:44804149-44804171 CTTCAAATCCTGAAGGAGACAGG - Exonic
906537197 1:46558020-46558042 TTTGATTTCCTGAATGAGGAAGG + Exonic
907661047 1:56392711-56392733 CTTTTTATTCTGAAGGAAGTGGG - Intergenic
909250638 1:73350341-73350363 CTTCAAATCCTGAAGGGTGATGG + Intergenic
909503772 1:76364190-76364212 CTTTATCTCCTGAAGGACCAAGG + Intronic
912414412 1:109498339-109498361 ATTTATATTCTGCAGGAGGAAGG + Intronic
915407558 1:155672816-155672838 GTTTTTATCCTGTAGTAGGAAGG - Intronic
915420251 1:155775258-155775280 GTTTTTATCCTGTAGTAGGAAGG - Intronic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916502212 1:165396692-165396714 CTGTATACCCTGAAGGGGTAGGG + Intergenic
924310395 1:242735586-242735608 CTTTATATATTGAAAGAGCAAGG - Intergenic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063279195 10:4606874-4606896 CTTCATATCCAGAAGAAAGAGGG + Intergenic
1064024543 10:11836662-11836684 CTGTATATCCTGACACAGGAAGG + Intronic
1066029187 10:31400162-31400184 CTTTATATTCTAGTGGAGGAAGG - Intronic
1066554012 10:36591228-36591250 TCCTATATTCTGAAGGAGGAAGG + Intergenic
1069543276 10:69311616-69311638 AATTGTATCCTGGAGGAGGAAGG - Intronic
1072066315 10:91874953-91874975 CTTTATCCCCTGAAGGATGCTGG - Intergenic
1074558837 10:114517010-114517032 CTTTTTATCCTCAAAGAGCAGGG + Intronic
1074692855 10:116022355-116022377 CTTTGTATCCTAAAGGTGGCAGG - Intergenic
1075295703 10:121273115-121273137 ATTAATATCCTGAAAGAAGAAGG + Intergenic
1076204127 10:128581753-128581775 CTTTAGGTCCTGAAAGTGGAAGG - Intergenic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1080685201 11:34509599-34509621 TTTTATATCCTGAGTGAGGGGGG + Intronic
1082061529 11:47865135-47865157 CTTTAAACCCTGAAAAAGGAAGG - Intergenic
1086388011 11:86329415-86329437 CTTTGTATCCTGAAGGATGAAGG + Intronic
1086559705 11:88153909-88153931 CTTTATATCAAGAAGGAAAATGG + Intronic
1087172540 11:95065192-95065214 CTTGATATTCTGCAGGTGGATGG + Intergenic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1087461647 11:98454979-98455001 CTTTAAATCCTGTAGGGAGAAGG + Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090636056 11:128691282-128691304 TTTTAAATCCTGAAAGGGGATGG - Intronic
1090870473 11:130741549-130741571 CTTAATATGCTCAAGAAGGAGGG - Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1092232903 12:6787058-6787080 CTTTCTAGTCTGAAGGAAGAAGG + Intronic
1093254429 12:16849323-16849345 CTTTATTTCATCAAGAAGGAAGG - Intergenic
1094456082 12:30634807-30634829 ATATATATCCTGAAGTGGGATGG - Intronic
1095498557 12:42811672-42811694 CCTTACAGCCTGAGGGAGGAGGG + Intergenic
1095577977 12:43760835-43760857 GTTTATATTCTAATGGAGGAAGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096284784 12:50289715-50289737 CTTTATATACTAAAAGAAGAAGG - Intergenic
1097093099 12:56523169-56523191 GTTTATATCCTGAAGAAATATGG + Intronic
1097391257 12:59017147-59017169 ATTTATATCCTAAAGAATGATGG + Intergenic
1098268248 12:68745409-68745431 CTTTATCGACTTAAGGAGGAAGG + Exonic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1099958086 12:89370696-89370718 CTTCATATCCTGCAGGAGAAAGG + Intergenic
1100560616 12:95745976-95745998 CATTACACCCTGAAGGAGGGAGG - Intronic
1101714975 12:107302696-107302718 CTTTATAACCTGGAGCATGAAGG - Intergenic
1102527248 12:113520678-113520700 CGTAATATCCTGACGGAGGTTGG - Intergenic
1107186708 13:37530915-37530937 CTTTATAAACTTAGGGAGGAAGG + Intergenic
1108844736 13:54663648-54663670 CTTAATATCCTAACGTAGGAAGG - Intergenic
1108866931 13:54935446-54935468 CTTTATCTCATGAATGAAGAAGG - Intergenic
1109122287 13:58472666-58472688 CTTTGAATCATGGAGGAGGAAGG - Intergenic
1109678666 13:65716683-65716705 TTTTATATCCTAAAGGGAGAAGG + Intergenic
1112168776 13:96947993-96948015 ATTTATCTCGTGAAGGAGAAAGG - Intergenic
1115043995 14:28967248-28967270 CTTTATTTAATGAAGGAGAAGGG + Intergenic
1115468229 14:33739350-33739372 CTTTATATCATAAAGGAGGCTGG - Intronic
1115791058 14:36878887-36878909 TTTTATATCATGAATGAGTAGGG - Intronic
1117957063 14:61130976-61130998 CTATTTGTCCTGGAGGAGGAGGG - Intergenic
1118833086 14:69453235-69453257 CTTTAGATCCAGAAGCAGCAAGG + Exonic
1120931583 14:89854403-89854425 CTTAGTATCCTGAATGAGGAGGG - Intronic
1122815160 14:104308531-104308553 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815164 14:104308554-104308576 CTCTATATCCCAAAGAAGGATGG + Intergenic
1122815168 14:104308577-104308599 CTCTATATCCCAAAGAAGGATGG + Intergenic
1122815176 14:104308623-104308645 CTCTATATCCCAAAGAAGGATGG + Intergenic
1122815180 14:104308646-104308668 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815184 14:104308669-104308691 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815188 14:104308692-104308714 CTCTATATCCCAAAGAAGGATGG + Intergenic
1122815194 14:104308738-104308760 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815198 14:104308761-104308783 CTCTATATCCCAAAGAAGGATGG + Intergenic
1122815210 14:104308830-104308852 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815218 14:104308876-104308898 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815222 14:104308899-104308921 CTCTATATCCCAAAGAAGGACGG + Intergenic
1122815226 14:104308922-104308944 CTCTATATCCCAAAGAAGGACGG + Intergenic
1126474149 15:49048384-49048406 CTTTCAATTGTGAAGGAGGACGG - Intergenic
1126761817 15:51976646-51976668 TTTAAAATCCTGAAGGAGGCCGG + Intronic
1127729828 15:61789547-61789569 CTTTATATAAGGAAGGAGGCAGG - Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1129250927 15:74308583-74308605 CTTTAAATCTTCAAGGAGGGGGG + Intronic
1130579083 15:85118576-85118598 GTTTAAATCCTGAGGGAGGTGGG - Intronic
1133211252 16:4264454-4264476 CTTTGGGTCCTGATGGAGGAGGG - Intronic
1135485609 16:22862198-22862220 CTTTAGATCCTAAAACAGGAAGG - Intronic
1135515119 16:23125473-23125495 TTTTATATCCAGCTGGAGGAAGG - Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140967933 16:79985237-79985259 CCTTATATTGTGAAGGAGAATGG + Intergenic
1141071724 16:80962560-80962582 CTGTATATCTTAAAGGAAGATGG - Intergenic
1142954648 17:3513384-3513406 CTGGATATCCTGGGGGAGGAGGG - Exonic
1145122607 17:20274003-20274025 GTTAATATCCTTAAGGAGAAAGG - Intronic
1146464780 17:33077746-33077768 TTTTCAAGCCTGAAGGAGGAGGG + Intronic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1148622322 17:49043875-49043897 CCTTGCATCCTCAAGGAGGAAGG - Intronic
1156071170 18:33211800-33211822 ATTTTTATCCTGAAGTAGCAAGG - Intronic
1159810310 18:73011445-73011467 CTTGTTAACCTGAAGAAGGAGGG - Intergenic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1166243650 19:41510664-41510686 CTTTATATCCCGAGGGGAGAAGG - Intergenic
1167252326 19:48406447-48406469 CCTTTAATCCTGAACGAGGATGG + Intronic
1168387415 19:55976224-55976246 TTTAATAGCCTGAAGGATGATGG + Exonic
925256832 2:2497577-2497599 CTTCTTATTTTGAAGGAGGATGG - Intergenic
926639091 2:15216117-15216139 CTTTACTTTCTAAAGGAGGAGGG + Intronic
927213904 2:20655358-20655380 CATCTTATCCTGAAGAAGGAGGG + Intergenic
929304725 2:40348025-40348047 CTTTATTTACTGAAGGAAGGAGG + Intronic
930489195 2:52046416-52046438 CTTTATATTCTGAAAGACCAGGG + Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
931733120 2:65170617-65170639 CTTTGTTTCCTCAGGGAGGAAGG + Intergenic
931991594 2:67795930-67795952 CTTTATGGCATGAAGGAAGAGGG - Intergenic
933474383 2:82770776-82770798 CTTTCTCTCTTGGAGGAGGAGGG - Intergenic
933607141 2:84395163-84395185 CTTTATCTATTGAAGCAGGATGG - Intergenic
935377844 2:102418575-102418597 CTTTATCTCATCAAGGAGGTTGG + Intergenic
936088027 2:109482730-109482752 CTTCCTCTCCTGCAGGAGGAAGG + Intronic
936548362 2:113412573-113412595 ATTTCTATTCTGAAAGAGGATGG - Intergenic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
939702832 2:145415384-145415406 CATTACATCCTGAAGGATGAAGG - Intergenic
940769296 2:157823617-157823639 CTTTAAATTCTGGAGGAGAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943124935 2:183784357-183784379 CTATATATACTTCAGGAGGAAGG - Intergenic
943513463 2:188855191-188855213 CTTTACATTTTGAAGGAAGATGG + Intergenic
945450326 2:209986959-209986981 CTTAAAATCCTGAAGTAGTAAGG + Intronic
947462052 2:230311867-230311889 CTTTATATGCTGCAGCAGGCAGG - Intronic
947471134 2:230402079-230402101 CTTTATATGCTGCAGCAGGCAGG - Intronic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
948003750 2:234590476-234590498 ATTTTTATCTGGAAGGAGGAGGG + Intergenic
948497622 2:238362585-238362607 GTAAATATCCTGAAGGAGAAGGG - Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1170723923 20:18908794-18908816 CTTTCTATCCAGACAGAGGAAGG - Intergenic
1170940196 20:20842325-20842347 CATTAATTCCTGAAGAAGGAGGG - Intergenic
1172462624 20:35131661-35131683 CTTCTTATCCTGAAGCAGGATGG + Exonic
1173632027 20:44523720-44523742 ATTTTTATCCAGAAGGAAGAAGG + Intergenic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1181359815 22:22325629-22325651 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1181368850 22:22400275-22400297 CTTTTTGTCCTGAAGGGGCAGGG - Intergenic
1181369880 22:22407362-22407384 CTTTGTGTCCTGAAGGGGCAGGG - Intergenic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1183651201 22:39154209-39154231 CCTTATATTCTTCAGGAGGAAGG + Intergenic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
950150021 3:10679642-10679664 CTTTATCTCCAGCAGGAGAATGG + Intronic
950584868 3:13885085-13885107 GATTATGTCCTGATGGAGGAGGG - Intergenic
950610390 3:14123241-14123263 CTGTAAATCCTCAAAGAGGAGGG + Intronic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
954725366 3:52604395-52604417 CTTTATTTCATAAATGAGGAAGG - Intronic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
955819923 3:62886006-62886028 ATATATTTCCTGAAGAAGGACGG + Intergenic
956087003 3:65622081-65622103 ATGTATTTCCTGCAGGAGGAAGG - Exonic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
957973963 3:87419662-87419684 TTTTATATCCTCATGGAGCAGGG - Intergenic
958027079 3:88060225-88060247 CATTATATATTGAAGGATGAGGG - Intronic
958153634 3:89725034-89725056 CTTTTAATCCTGAAGAATGATGG + Intergenic
959491955 3:107001039-107001061 CTTTAAAACCTGAAGGATGGAGG + Intergenic
960339053 3:116453063-116453085 CTTTAGATTCTGGAGGAGGGAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961693641 3:128688716-128688738 ATATATACTCTGAAGGAGGAAGG + Intergenic
962020471 3:131495441-131495463 TTTTATATCTTGAAGAAAGAAGG + Intronic
962448921 3:135495012-135495034 TATTTTACCCTGAAGGAGGAAGG - Intergenic
964038409 3:152227434-152227456 CTATATATGCTGAAGAACGAGGG + Intergenic
965601860 3:170462464-170462486 CTATAGATTCTGAAGAAGGATGG + Exonic
966275809 3:178166897-178166919 CTTTTTATCCTGAAGGGTGTTGG - Intergenic
968933628 4:3597643-3597665 CTTTCTATCCTGCAGCCGGAAGG + Intergenic
970713095 4:18887484-18887506 CTTTATTCCCTGAATAAGGAGGG - Intergenic
970991297 4:22216248-22216270 CTCTAGATTCTGAAGGAGGTGGG + Intergenic
972433363 4:39006536-39006558 CTTTTTAACCTTAAGGAAGAAGG - Intronic
973936175 4:55849184-55849206 CTTGAACCCCTGAAGGAGGAAGG - Intergenic
975747698 4:77491140-77491162 ATTTATATCCTGGTGGATGATGG - Intergenic
978679974 4:111368445-111368467 TTATTTATCCTGAAGGAAGAAGG + Intergenic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
980881587 4:138715992-138716014 CTCTACATCCTGAAGGAAGGTGG + Intergenic
981136805 4:141220225-141220247 TTTTATCTCCTGCAGGGGGAGGG + Intergenic
982879943 4:160701275-160701297 GTTTTTATGCTGAAGAAGGAAGG + Intergenic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
986503768 5:8428970-8428992 CTTAATATAGTGAATGAGGAAGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987826730 5:23039602-23039624 CTTTATATCAGGAAAGTGGAAGG + Intergenic
988923039 5:35962303-35962325 CTTTAAGTCCTGTAGGGGGAAGG + Intronic
991706078 5:69360112-69360134 CTATATTTCCTGAAGGAGAATGG + Intronic
993870602 5:93249592-93249614 TTTTATTTCCTGAATAAGGAAGG + Intergenic
993921193 5:93805298-93805320 CTTTATATAGTGAAGGAGCAAGG - Intronic
995222827 5:109670303-109670325 ATTTATTTTCTGGAGGAGGAAGG - Intergenic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996973865 5:129407363-129407385 ATTTATATCCTGAAGCAGTAGGG - Intergenic
997793148 5:136781114-136781136 CTTTATATCCTCCAGGAGAGAGG + Intergenic
998549880 5:143067119-143067141 CTTAATTTCCTGGAGGGGGATGG + Intronic
999068677 5:148718850-148718872 GTTTCTATTCTGAAGGAGGAAGG - Intergenic
1000102774 5:158032691-158032713 CCATATATCCTGAAGTAGAAGGG - Intergenic
1000339878 5:160268864-160268886 CTTGATTTCCTGAGGGAGAAAGG - Intronic
1005027243 6:21474910-21474932 CTTTATCTCATGGAGGAGTAAGG - Intergenic
1005055728 6:21727185-21727207 CTATATTTGCTGATGGAGGAGGG - Intergenic
1006208682 6:32374373-32374395 CTTTAAATCCTGTAGGAAGAAGG - Intergenic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1009366886 6:62863222-62863244 CTTAATATTCTGAAGGGGAAAGG - Intergenic
1010977093 6:82328093-82328115 ATTTACATCCTCAAGGAAGATGG - Intergenic
1011155883 6:84330977-84330999 CTATATAGCCTTAAAGAGGAGGG + Intergenic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1012052711 6:94363410-94363432 CTTTATATCTTTAAGAAGAATGG - Intergenic
1012443121 6:99280769-99280791 CTTCAAATCCTGGTGGAGGAAGG + Exonic
1012589612 6:100964798-100964820 CTTTTGATCCTGATGTAGGAAGG - Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016079062 6:139833685-139833707 CTCTAAATCCTGAAAGAGGTTGG + Intergenic
1017784625 6:157745047-157745069 CTTTCTAACTTTAAGGAGGATGG + Intronic
1017813194 6:157999085-157999107 CTATAGATCATGAAGAAGGAAGG + Intronic
1018055808 6:160051282-160051304 CTTTGGAGCCTGAATGAGGAAGG + Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1019029798 6:169000398-169000420 CTATAAATTCTGAAGGAAGAGGG - Intergenic
1019642946 7:2114412-2114434 CTTTGTGGCCTTAAGGAGGATGG - Intronic
1022717611 7:32912905-32912927 CTTTATATACTGTAAGAGAATGG + Intergenic
1024233699 7:47382056-47382078 ATTTGTATCCTGTAGGAGGCTGG - Intronic
1024353788 7:48394245-48394267 ATTTATATTCCAAAGGAGGAGGG - Intronic
1026975556 7:74495625-74495647 CTCCACATCCTGGAGGAGGAGGG + Intronic
1028729871 7:94133873-94133895 CTTTATATTCTAAAGTGGGAAGG + Intergenic
1031683094 7:124699019-124699041 CCTTATATTCTGAGTGAGGATGG - Intergenic
1032317609 7:130854365-130854387 GTTCTTATCCTGAAGGAGCATGG + Intergenic
1032694323 7:134320849-134320871 CTCTATATTGTGCAGGAGGAAGG + Intergenic
1033715007 7:143991804-143991826 TTTTCTTCCCTGAAGGAGGATGG + Intergenic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1036797801 8:11768764-11768786 CTTTAGTTCTCGAAGGAGGATGG - Intergenic
1037959915 8:23089200-23089222 CTTTCTACCCTGAAGTAGGTAGG - Intronic
1038238510 8:25785308-25785330 ATTTGGATCCTGGAGGAGGAAGG + Intergenic
1040918373 8:52587393-52587415 CTTTATATCCTGTGGGAAAAAGG - Intergenic
1041990671 8:63987026-63987048 ATTTATATCTTGAAAGAGGAAGG + Intergenic
1042011285 8:64247832-64247854 CTTTTTATCCAGAAAGAGAAAGG - Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1042081942 8:65063388-65063410 AGTTATATTCTGAATGAGGAAGG + Intergenic
1042665524 8:71200782-71200804 ATTTATATCTTGTAGGAGGTGGG + Intronic
1042723434 8:71847906-71847928 CTTAATATGCTGTTGGAGGAAGG - Intronic
1044937341 8:97305848-97305870 CTTCACATCATGAAGGATGAGGG + Intergenic
1049915463 9:313203-313225 CTTTAGATCATCAAAGAGGAAGG - Intronic
1052274527 9:26662420-26662442 TTTTTCATCCTGCAGGAGGAAGG + Intergenic
1052706671 9:32001678-32001700 TTATTTAGCCTGAAGGAGGATGG + Intergenic
1053727202 9:41016174-41016196 ATTTCTATTCTGAAAGAGGATGG + Intergenic
1054456517 9:65434174-65434196 CTTTCTATCCTGCAGCCGGAAGG - Intergenic
1054701315 9:68415914-68415936 ATTTCTATTCTGAAAGAGGATGG - Intronic
1055026248 9:71725067-71725089 CTATATATCCTGAACAGGGAGGG + Intronic
1056019393 9:82425518-82425540 CTTTAGATCTTGAAGCAGCATGG + Intergenic
1058238614 9:102526127-102526149 CTGTATATCCTGAAAGAATAAGG - Intergenic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1061693005 9:132349909-132349931 CTTTATATCTAAAAAGAGGAGGG - Intronic
1185776475 X:2806686-2806708 TTTTCTATCCTGCAGGAAGAGGG + Exonic
1186389913 X:9148548-9148570 ATTTATTTGCTGCAGGAGGATGG - Intronic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1187236645 X:17474304-17474326 CTTTATATCCTGAGAGAGCTAGG + Intronic
1190452721 X:50597131-50597153 CTTTGTTTCCTGTAGCAGGAGGG + Intronic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192194830 X:69021286-69021308 ATTTATAACCTGTAGCAGGAGGG - Intergenic
1193201794 X:78699950-78699972 CTTTATATTTTGAAGCAAGAGGG + Intergenic
1196129732 X:112142402-112142424 CTTCCTATCCTGATGGTGGAAGG + Intergenic
1197164279 X:123359504-123359526 CTTTATATCCCCAAGGATAACGG - Intronic
1197534459 X:127670679-127670701 CTTTATATCCTGTAGCTGCAAGG + Intergenic
1199586145 X:149418357-149418379 TTTTATATACTGCTGGAGGAGGG + Intergenic
1200450501 Y:3321720-3321742 ATTTATATTCTAAAAGAGGAGGG - Intergenic
1201293503 Y:12444792-12444814 TTTTCTATCCTGCAGGAAGAGGG - Intergenic
1202345374 Y:23917804-23917826 AATTATTTTCTGAAGGAGGAGGG - Intergenic
1202525396 Y:25752285-25752307 AATTATTTTCTGAAGGAGGAGGG + Intergenic