ID: 1127871533

View in Genome Browser
Species Human (GRCh38)
Location 15:63078009-63078031
Sequence AAGGCTCCTTCAGACCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127871533_1127871538 5 Left 1127871533 15:63078009-63078031 CCAGGGAGGTCTGAAGGAGCCTT No data
Right 1127871538 15:63078037-63078059 TCTGGTAAAGCAAATGGATGAGG No data
1127871533_1127871537 -1 Left 1127871533 15:63078009-63078031 CCAGGGAGGTCTGAAGGAGCCTT No data
Right 1127871537 15:63078031-63078053 TTGGTTTCTGGTAAAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127871533 Original CRISPR AAGGCTCCTTCAGACCTCCC TGG (reversed) Intergenic
No off target data available for this crispr