ID: 1127871538

View in Genome Browser
Species Human (GRCh38)
Location 15:63078037-63078059
Sequence TCTGGTAAAGCAAATGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127871530_1127871538 14 Left 1127871530 15:63078000-63078022 CCTACTCCACCAGGGAGGTCTGA No data
Right 1127871538 15:63078037-63078059 TCTGGTAAAGCAAATGGATGAGG No data
1127871526_1127871538 30 Left 1127871526 15:63077984-63078006 CCTATAAAATCAGCTTCCTACTC No data
Right 1127871538 15:63078037-63078059 TCTGGTAAAGCAAATGGATGAGG No data
1127871532_1127871538 8 Left 1127871532 15:63078006-63078028 CCACCAGGGAGGTCTGAAGGAGC No data
Right 1127871538 15:63078037-63078059 TCTGGTAAAGCAAATGGATGAGG No data
1127871533_1127871538 5 Left 1127871533 15:63078009-63078031 CCAGGGAGGTCTGAAGGAGCCTT No data
Right 1127871538 15:63078037-63078059 TCTGGTAAAGCAAATGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127871538 Original CRISPR TCTGGTAAAGCAAATGGATG AGG Intergenic
No off target data available for this crispr