ID: 1127874466

View in Genome Browser
Species Human (GRCh38)
Location 15:63099921-63099943
Sequence ATACATGTATAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127874462_1127874466 25 Left 1127874462 15:63099873-63099895 CCACTTATTTTGACATAGTTTGC No data
Right 1127874466 15:63099921-63099943 ATACATGTATAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127874466 Original CRISPR ATACATGTATAGATGGAAAA GGG Intergenic
No off target data available for this crispr