ID: 1127877328

View in Genome Browser
Species Human (GRCh38)
Location 15:63122293-63122315
Sequence GGGCTGAGTGGACCCCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 4, 3: 22, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127877320_1127877328 -1 Left 1127877320 15:63122271-63122293 CCCCTGTCGGCGGTGCTGTCGGG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG 0: 1
1: 1
2: 4
3: 22
4: 228
1127877322_1127877328 -2 Left 1127877322 15:63122272-63122294 CCCTGTCGGCGGTGCTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG 0: 1
1: 1
2: 4
3: 22
4: 228
1127877316_1127877328 10 Left 1127877316 15:63122260-63122282 CCGGGGATCCACCCCTGTCGGCG 0: 1
1: 0
2: 1
3: 34
4: 179
Right 1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG 0: 1
1: 1
2: 4
3: 22
4: 228
1127877318_1127877328 2 Left 1127877318 15:63122268-63122290 CCACCCCTGTCGGCGGTGCTGTC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG 0: 1
1: 1
2: 4
3: 22
4: 228
1127877324_1127877328 -3 Left 1127877324 15:63122273-63122295 CCTGTCGGCGGTGCTGTCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG 0: 1
1: 1
2: 4
3: 22
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127877328 Original CRISPR GGGCTGAGTGGACCCCACCC GGG Intronic
900179038 1:1303370-1303392 GCCCTGAGTGGAACCTACCCTGG - Intronic
900206532 1:1434137-1434159 GGGCCGAGGGTCCCCCACCCTGG - Intergenic
900556912 1:3285186-3285208 GGGCTGTGTGGACTGCAGCCAGG + Intronic
900611207 1:3545342-3545364 GGGCTGAGTGGACCCTTCTGAGG + Intronic
900796972 1:4713850-4713872 GGGCTCGGTAGGCCCCACCCAGG + Intronic
900890890 1:5448972-5448994 GAGCTGAGTGGGCCCAGCCCAGG + Intergenic
901628140 1:10635075-10635097 GGCCTGGATGGACCACACCCAGG - Intergenic
901772433 1:11537188-11537210 GGGGTGAGAGGCCCCCACCCTGG - Exonic
903179440 1:21597915-21597937 GTGCTGAGGGAGCCCCACCCGGG - Intronic
903649229 1:24912959-24912981 GGTCTCAGTGGACTCCACCAGGG + Intronic
905025433 1:34846351-34846373 GAGCTGAGGGGACCCTGCCCGGG - Intronic
905206526 1:36345777-36345799 GGGCTGAGGGAACCCTACACAGG - Intronic
906348774 1:45039011-45039033 GGGCTGGGTGGGCCACCCCCTGG - Exonic
906376446 1:45300393-45300415 AGGCTGAGTGGTCCCCAGCCTGG - Intronic
914371691 1:147031005-147031027 GGGCTGTGTGTAGTCCACCCTGG + Intergenic
914373475 1:147051321-147051343 GGGAAGAGTGGTCCCCACGCTGG - Intergenic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
916213787 1:162379127-162379149 GAGATGACTGGACCCCAGCCAGG - Intronic
917517633 1:175721452-175721474 TGGCTGTGTTCACCCCACCCAGG + Intronic
918141268 1:181721808-181721830 TGCCTGAGCTGACCCCACCCTGG - Exonic
922194319 1:223346508-223346530 TGGCTGAGTGCCCCCCAGCCTGG + Intronic
922481306 1:225941385-225941407 GGGCTGTCTGGATGCCACCCAGG + Exonic
922758558 1:228109842-228109864 GGGCTGAGTGGGCACCAGCTGGG + Intergenic
1062938412 10:1404483-1404505 GGGAGGAGTGGAGCCCACGCTGG - Intronic
1063361495 10:5463055-5463077 GGGCTCAGTGGTGCCCTCCCAGG + Intergenic
1063464399 10:6233521-6233543 TGGCTGGGTGGTCCGCACCCTGG + Exonic
1067757499 10:49016006-49016028 TGCCCGAGTGGGCCCCACCCTGG - Exonic
1067771755 10:49131633-49131655 GTGCTGAGAGCACCTCACCCTGG + Exonic
1069208093 10:65718392-65718414 TGGCTGATTGAGCCCCACCCAGG + Intergenic
1069593676 10:69656882-69656904 GGCCTGGGGGGACCACACCCAGG - Intergenic
1071452541 10:85810803-85810825 TAGCTGAGTAGACCCAACCCTGG + Intronic
1074772575 10:116743045-116743067 GGGCTGGGTGGACCCCGGCGCGG + Intergenic
1075802672 10:125162111-125162133 GGGCTCAGTTCAGCCCACCCAGG - Intergenic
1076474018 10:130739988-130740010 GGGCTGAGTGGCCACCACCCAGG + Intergenic
1076586738 10:131553862-131553884 TGCCTGAGTGGTCCCCACGCTGG - Intergenic
1076869976 10:133188434-133188456 GGGCTGAGTGGGCCTCACCCTGG + Intronic
1077085536 11:747971-747993 GGGCGCAGCCGACCCCACCCTGG - Intronic
1078873319 11:15369608-15369630 TGGCTCAGTGAATCCCACCCTGG - Intergenic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1083685635 11:64373424-64373446 GGTCTGCCTGAACCCCACCCTGG + Intergenic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1084962889 11:72726600-72726622 GAGGTGAGTGGATGCCACCCAGG - Exonic
1085715654 11:78870955-78870977 GGTCTTAGTAGAGCCCACCCGGG - Intronic
1088041054 11:105382637-105382659 GGGATGACTGCACCCCAGCCAGG - Intergenic
1088500422 11:110477489-110477511 GCGCTGAGTGGACCGAAACCTGG - Intergenic
1089401879 11:118169071-118169093 AGGCTGAGTGGGCCCCTGCCAGG - Intronic
1089731276 11:120520623-120520645 GTGGTGAGTGGACACAACCCTGG - Intronic
1089738377 11:120564852-120564874 GGGCTGACTGGACCCGGCTCAGG + Intronic
1090198613 11:124838586-124838608 GGGCTGTGTCCACCCCACCTGGG + Intergenic
1090934701 11:131331018-131331040 AGGCTGAGTGGACCCCTTCTTGG + Intergenic
1091365640 11:135017514-135017536 GGGCAGAGGGGAGCCCACCTGGG - Intergenic
1091750342 12:3018301-3018323 GTGCTGTGTGGACCACACCTGGG + Intronic
1092596369 12:10009685-10009707 GGGGTGAGTGCACCTCACGCTGG + Intronic
1093972243 12:25385918-25385940 GGTTTGAGCCGACCCCACCCCGG - Intergenic
1094385465 12:29888902-29888924 GGGCTTGGTGGACCCCGCACTGG - Intergenic
1097447078 12:59684657-59684679 GGGCAGAGTGGAACCCAGTCAGG + Intronic
1097664207 12:62461525-62461547 GGGCTCGGTGGGCCCCACACTGG - Intergenic
1101061572 12:100977988-100978010 GGACTGAGTAGACCTCACCTTGG - Intronic
1102347507 12:112169238-112169260 GTGCTGATTGGCCCCCTCCCCGG - Intronic
1102633492 12:114302283-114302305 GGGCTGACCGGTCTCCACCCTGG - Intergenic
1104854620 12:131895919-131895941 GGGCCCAGTAGACCCCAGCCTGG - Intronic
1104984242 12:132587639-132587661 GGGGGGAGGGGACCCCATCCAGG + Intergenic
1108618605 13:52159523-52159545 CGGGTGAGTGGTCCCCGCCCTGG - Exonic
1112746925 13:102536970-102536992 GGGCTTTGTGCTCCCCACCCTGG + Intergenic
1113592863 13:111513018-111513040 CGGCTGAGGTGACCCCACGCTGG + Intergenic
1113711388 13:112467450-112467472 GAGCTGTCTGGACCCCACCGAGG - Intergenic
1116471032 14:45285903-45285925 GGGCTGCTTGCACCCCAGCCTGG - Intergenic
1121723224 14:96126735-96126757 GGGCTGTGCCCACCCCACCCAGG - Intergenic
1122232121 14:100311596-100311618 GGGCTGAGTTGCCGCCACCTTGG + Intergenic
1122309798 14:100787339-100787361 GGGCGGAGTTGACCCCACTGGGG + Intergenic
1124848968 15:33317438-33317460 TGGCTGAGAGGACACCAGCCTGG - Intronic
1125063988 15:35459661-35459683 GGGCTGAGTGGAAGACACCGGGG + Intronic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1128126516 15:65197213-65197235 GGACCGTGTGGACCGCACCCTGG - Exonic
1128520731 15:68373090-68373112 GTGGTGTGTGTACCCCACCCTGG + Intronic
1129162333 15:73753482-73753504 GGACTGACCGGACCCCACGCCGG + Intergenic
1129699398 15:77758947-77758969 GAGTGGAGTGGACCCCACTCTGG - Intronic
1129889322 15:79060603-79060625 GGGCTGAAGGGACCCCTCCCTGG + Intronic
1130443489 15:83977885-83977907 GGGCTGAGAGGAGGCCACCAGGG - Intronic
1131301950 15:91207468-91207490 GGTCTGTGTGGTCCCCACCAAGG + Intronic
1132516567 16:368751-368773 GTGCTGAGGCGGCCCCACCCGGG - Intronic
1132716317 16:1291874-1291896 GGGCTGAGCGGCGCCCACCCAGG - Intergenic
1133233903 16:4378947-4378969 GGCCTGCGTGGGCCCAACCCCGG + Intronic
1135304134 16:21354497-21354519 GGGCTGTGTGACCCCCACCACGG - Intergenic
1138505756 16:57477529-57477551 GGGCTGCATGGAGCCCACCCTGG - Intronic
1139516794 16:67457105-67457127 GGGATGAGGGGACTCCCCCCTGG - Intronic
1140663986 16:77212411-77212433 GGGCGGAGGGGAACCCGCCCAGG + Intronic
1141376577 16:83536334-83536356 GGGCTGAGTTGACCTGACCACGG + Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142282037 16:89153767-89153789 GGGCAGAGGGGCCCCCACACCGG - Intronic
1142619815 17:1157812-1157834 GGGCTGAGTGCACCCCATCGTGG - Intronic
1144788538 17:17845082-17845104 GGGCTAAGTGGAACCCACTCTGG + Intronic
1146059493 17:29596930-29596952 GGGCTGTGGGGACCGCACCCTGG - Intronic
1147732790 17:42614391-42614413 GGGAGAGGTGGACCCCACCCAGG + Exonic
1147740047 17:42666218-42666240 GGGAGAGGTGGACCCCACCCAGG + Exonic
1147975877 17:44247851-44247873 GGGCTAGGTGTCCCCCACCCCGG - Intergenic
1151318974 17:73341494-73341516 CAGCTCAGAGGACCCCACCCAGG + Intronic
1152225548 17:79091057-79091079 GGGCTGCCTGGGCCCCATCCTGG - Intronic
1152403441 17:80083100-80083122 GGTCTCTGTGGAGCCCACCCTGG - Intronic
1152926504 17:83090120-83090142 GGGGTGTGTGGCTCCCACCCTGG - Intronic
1152926519 17:83090152-83090174 GGGGTGTGTGGCTCCCACCCTGG - Intronic
1152926533 17:83090184-83090206 GGGGTGTGTGGCTCCCACCCTGG - Intronic
1153593529 18:6700295-6700317 GAACTGAGTGGAGCCCACCACGG + Intergenic
1153616347 18:6938194-6938216 CGGCTGAGGGGAACACACCCAGG + Intergenic
1154014537 18:10604751-10604773 GGCCTGAGTGGACTGCTCCCGGG + Intergenic
1155920909 18:31601889-31601911 GGGCTGGCTGGAGCCCACCAAGG + Intergenic
1159043965 18:63351034-63351056 GGGCAGCGTGTACCCCAGCCGGG - Exonic
1160006879 18:75074644-75074666 GGGCTGTGTGCCTCCCACCCTGG + Intergenic
1160101840 18:75927802-75927824 AGGCTGACTGTACCTCACCCAGG - Intergenic
1160970510 19:1765835-1765857 AGGCAGAGAGGAGCCCACCCTGG + Intronic
1161091141 19:2360542-2360564 GGGCTGTGTGGACGCCACTGGGG + Intergenic
1161731082 19:5960983-5961005 GATCTGATTGGACTCCACCCTGG - Intronic
1162329499 19:10018913-10018935 GAGCTGTGGGGACCCAACCCTGG + Intronic
1162722063 19:12668459-12668481 GGGGTGGGGGGACCCCAGCCTGG - Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1163609080 19:18291939-18291961 GGGGAGAGAGGACCCCACCCCGG + Intergenic
1163618708 19:18344782-18344804 GGGCTGAGTGGACACAAAGCCGG + Intronic
1165691714 19:37868730-37868752 GGACTGAATGGACCCCATCTTGG - Intergenic
1166742581 19:45123246-45123268 GGGGTGAGTGCACCCCAGGCTGG + Intronic
1166848440 19:45745078-45745100 GGGCTGCCCGCACCCCACCCTGG - Intronic
1167410133 19:49339512-49339534 GGGCGGAGCGCAGCCCACCCCGG + Intronic
1168707772 19:58479723-58479745 GGGCTGGCTGGTCCTCACCCAGG - Exonic
926058752 2:9792257-9792279 GGGCTGAGTGGACACAACCCAGG + Intergenic
926730089 2:16030205-16030227 GGGCTGGGGGGTCCCCACCTTGG + Intergenic
927193847 2:20534498-20534520 GGGCTTCCTGGTCCCCACCCTGG - Intergenic
927961356 2:27242349-27242371 GGTCGGAGAGCACCCCACCCAGG + Exonic
928453999 2:31403120-31403142 GGGCTGAGTGGAACCAAGCTCGG - Exonic
930855198 2:56008762-56008784 GGGCTGAGAGGACAAAACCCTGG - Intergenic
934766712 2:96883854-96883876 GGGCTGAGAGCAGCCCAGCCAGG - Intronic
935492270 2:103735345-103735367 GGGCTGAGTGGGCCAGTCCCTGG + Intergenic
937058920 2:118967173-118967195 GGGCTGGGTGGAACCCCCCTTGG - Intronic
937337916 2:121072986-121073008 TGCCTGAGTGGAGCCCAGCCCGG - Intergenic
938199526 2:129361766-129361788 GGGCTGTGAGGTCCCTACCCGGG - Intergenic
939275231 2:139990991-139991013 GGGCTCGGCGGACCCCGCCCTGG - Intergenic
942444081 2:176066909-176066931 GGGCTGTGTGGAGCCTACGCCGG + Intergenic
947230059 2:227875518-227875540 GGGCAGAGGTGTCCCCACCCAGG + Intronic
948032253 2:234828467-234828489 TGGCCTTGTGGACCCCACCCAGG - Intergenic
948650879 2:239442950-239442972 AGGCTTAGTGGACTCTACCCTGG - Intergenic
948887243 2:240890443-240890465 GGGCTGAGTGGTTCCAACCTGGG - Intronic
1171390578 20:24799147-24799169 GGGGTGGGTGGACCCATCCCAGG + Intergenic
1173933956 20:46845257-46845279 TGGCTGATTTGACCACACCCAGG + Intergenic
1174499783 20:50976108-50976130 GGGCAGAGTGGAGCCCATCCTGG + Intergenic
1175542594 20:59757130-59757152 GGGCTGTGGGGACCACACCACGG - Intronic
1175768145 20:61605304-61605326 AGGCAGAGTGGGCCCCACCAAGG - Intronic
1175957130 20:62617104-62617126 GAGAGGAGTGGACCCCACGCAGG + Intergenic
1176088247 20:63307681-63307703 GAGCTGTGGGGACCACACCCGGG - Intronic
1176236583 20:64056401-64056423 GACCCCAGTGGACCCCACCCAGG - Intronic
1180080937 21:45487264-45487286 GGCCTGGGTGGAGCCCCCCCGGG - Intronic
1181412368 22:22733275-22733297 GGGCTGTCTGGATCCCAGCCAGG + Intergenic
1181671545 22:24427744-24427766 GGGGTGAGTGGCCCCCAGGCGGG + Intronic
1181960080 22:26616509-26616531 GGGATGAGTGGCCCCCAGACGGG - Intronic
1182417863 22:30232938-30232960 GGGCTGAGTACACCTCCCCCCGG + Intergenic
1183088615 22:35505329-35505351 GGGGAGAGTGGACTCCACCTGGG + Intergenic
1183655815 22:39184177-39184199 GGGCAGAATCTACCCCACCCTGG + Intergenic
1184210079 22:43030319-43030341 AGGCTGAGAGCACCCCACCCTGG + Intergenic
1184924062 22:47625187-47625209 GGGCTCAGTCGTCCCCACCTGGG - Intergenic
1184945554 22:47801567-47801589 GGGGTGTGCGGCCCCCACCCTGG - Intergenic
1185018009 22:48356949-48356971 GGGCTGAGGGAGCCACACCCAGG + Intergenic
1185162319 22:49237400-49237422 GGGCTAAGTGGCCCCTCCCCTGG - Intergenic
950358235 3:12429646-12429668 AGGCTGAGTGGTCCCAGCCCAGG + Intronic
950815963 3:15702711-15702733 TGGCTGAGTGGTCCTTACCCAGG - Intronic
951043491 3:18013373-18013395 GGGATGAGTGGAACCTAGCCAGG + Intronic
952152390 3:30606975-30606997 CGGGTGAGTGGTCCCCAGCCCGG + Exonic
952897545 3:38087942-38087964 GAGCTGAGTGGGCCCTCCCCTGG - Intronic
954369023 3:50160664-50160686 GGGCTGAGTCGACCCCACCCAGG - Intronic
954374800 3:50188617-50188639 TGGCTGAGTGCCCCCAACCCAGG - Exonic
955346421 3:58165093-58165115 GTGCCGAGAGGACCCCACCTGGG - Intronic
955401959 3:58598482-58598504 GGGGTGGGTGGCTCCCACCCAGG - Intronic
955410766 3:58654034-58654056 GGGCTAAGTGGAGCCCAGGCAGG - Intronic
956683707 3:71805014-71805036 GGTTTGAGTGGACCCTCCCCTGG + Intergenic
958912221 3:100006673-100006695 GGGCTGAGTGCAACCCAAGCTGG - Intronic
960948964 3:122986736-122986758 TGGCTGAGTGGACACCCCCTTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961665375 3:128490746-128490768 GGGCTGCGTTGACCCTCCCCGGG - Intronic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
963760573 3:149284090-149284112 GGGCTCGGTGGGCCCCACACTGG + Intergenic
964010389 3:151885533-151885555 GGACTGGGTGGAGCCCACCGCGG + Intergenic
966482305 3:180424565-180424587 CGGCTGAGGGGAGCACACCCAGG - Intergenic
967040698 3:185689503-185689525 GGGAAGAGTGGTCCCCACGCTGG + Exonic
967100360 3:186210754-186210776 GGGCCAAGAGGAGCCCACCCTGG + Intronic
968502920 4:959496-959518 TGGCTGGGTGCACCCCAGCCTGG + Exonic
968544812 4:1193415-1193437 AGTCTCAGTGGGCCCCACCCTGG + Intronic
968655074 4:1774928-1774950 GGGATGAGTAGACCCCACATGGG + Intergenic
969477281 4:7428736-7428758 CAGCCGGGTGGACCCCACCCTGG - Intronic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
972778593 4:42266009-42266031 GGGCTCAGTGGGCCCCACACTGG + Intergenic
976128369 4:81857324-81857346 GAGCTGGGTGTACCACACCCAGG - Intronic
978402052 4:108341527-108341549 GGGCTCGGTGCACCACACCCAGG - Intergenic
980825166 4:138063842-138063864 GGGCTGAGCCATCCCCACCCAGG - Intergenic
983949437 4:173622302-173622324 GGACAGAGTGGAGCCCACCGCGG - Intergenic
985552953 5:542538-542560 GGGCTCAGTGGGCCCCAGGCAGG - Intergenic
985553194 5:543518-543540 GGGCTCAGTGGGCCCCAGGCAGG + Intergenic
985573695 5:663999-664021 GGGCTGAGCAGAGCCCATCCAGG - Exonic
985660722 5:1155549-1155571 GGGCTGGGGGGACCCCAGGCAGG + Intergenic
986152518 5:5140385-5140407 GGGCAGGGAGGACCCGACCCAGG - Exonic
986708637 5:10471558-10471580 GGGCTGAGGGGAGCCCACAAGGG + Intronic
987218849 5:15768743-15768765 GGGCTGAGTGGAGCCCTGGCTGG - Intronic
997736180 5:136214134-136214156 GGGCTGAGTGGACCGTGCTCAGG - Intronic
998092969 5:139381717-139381739 GGGCAGCGTGGCCCCAACCCTGG - Intronic
1001159213 5:169299601-169299623 GGACTAAGAGGAGCCCACCCCGG + Intronic
1002296067 5:178232136-178232158 CGCCTGAGAGGACCTCACCCAGG - Intronic
1003387527 6:5683049-5683071 GGGCTGTGTGGGCCTCAGCCTGG + Intronic
1006730793 6:36234854-36234876 GGGCACAGTGGAGCCCACCTAGG + Intergenic
1012474888 6:99607401-99607423 GCGCTCAGTGCACCCCACCCAGG - Intronic
1019140396 6:169938851-169938873 GGGGAGAGTGGACCCCAGTCAGG - Intergenic
1019318762 7:405461-405483 GGGCTGTGTGGCCTCCACCCTGG - Intergenic
1019513591 7:1430117-1430139 GGGGTGAGGGGGCCCCACCATGG + Intronic
1019623513 7:2003809-2003831 GGGCTGTGTGGACCCCACACTGG + Intronic
1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG + Intronic
1020010405 7:4803294-4803316 TGGCTGGGTGGCCCCCTCCCCGG + Intronic
1020010436 7:4803369-4803391 TGGCTGGGTGGCCCCCTCCCCGG + Intronic
1020010469 7:4803444-4803466 TGGCTGGGTGGCCCCCTCCCCGG + Intronic
1023812110 7:43919673-43919695 GGGAGAGGTGGACCCCACCCAGG + Intronic
1032501866 7:132405626-132405648 GGGCTGAGTGGATGCCCCACAGG + Intronic
1032861611 7:135885148-135885170 GGGCTTTGTGGACCCGACACAGG - Intergenic
1033409365 7:141103173-141103195 GAGATGAGTTGACCCCACCTGGG - Intronic
1034468531 7:151243795-151243817 GGGCTGTGGGAACCCCAGCCAGG - Intronic
1035610793 8:962690-962712 GAGCAGAGTGGAACCCTCCCTGG + Intergenic
1037910854 8:22742808-22742830 GGGCTGAGTTGACATCAGCCAGG - Intronic
1042566063 8:70113467-70113489 CAGCCGAGTGGACGCCACCCTGG + Exonic
1045137247 8:99234108-99234130 CGGAAGAGTGGTCCCCACCCTGG + Intronic
1047803932 8:128339121-128339143 GGTGTGAGTGGACACCAACCTGG + Intergenic
1048046868 8:130780928-130780950 GGGGTGTTTGGACCCCTCCCTGG + Intronic
1048975890 8:139672862-139672884 GGGCAGGGTGGAACCCACGCAGG - Intronic
1049217534 8:141415026-141415048 CGACTCAGTGGACCCCACCCAGG - Intronic
1049276512 8:141722783-141722805 GGGGTGATTGGACCCCTCGCAGG - Intergenic
1049671653 8:143872758-143872780 GGGCCTGGTGGACCCCGCCCAGG - Exonic
1049758671 8:144322041-144322063 GGGCTGAAAGGAACCCACCCGGG + Intronic
1049759992 8:144327590-144327612 GGGCTGAGAAGACACCACCAAGG - Intergenic
1051218068 9:14820346-14820368 GGGCTCTGAGGACCCCTCCCAGG + Intronic
1055712885 9:79083953-79083975 GGACTGAGTGCACCGCACCAAGG - Intergenic
1056764354 9:89435761-89435783 GGTCTGGGTGCACCCCTCCCAGG + Intronic
1056764980 9:89439412-89439434 TGGCTGAGTGGAGACCACTCTGG + Intronic
1057047580 9:91898020-91898042 GGGGTGTGTGGACCCCGCCGTGG - Intronic
1057073736 9:92123014-92123036 GGGGTGGGTGGACCCCTGCCGGG - Intergenic
1057144598 9:92749426-92749448 GGGCTGAGAGGCACCCACACAGG + Intronic
1058727501 9:107817863-107817885 GGGCTCAGCGGGCCCCACACTGG + Intergenic
1058960631 9:109989707-109989729 TGGCTGTGTGGATTCCACCCAGG + Intronic
1059305362 9:113349625-113349647 GGGCAGAGTGGCCCCGGCCCGGG - Exonic
1060106477 9:120876440-120876462 GGGCTGGGGGGGCGCCACCCGGG - Intronic
1060968280 9:127723697-127723719 TGGCTGGGTGGACCGCCCCCTGG - Intronic
1061390399 9:130314595-130314617 GGGCTGTGGAGACCCCTCCCCGG + Intronic
1062154396 9:135038526-135038548 GGGCTGGGAGGATCCCACCCAGG + Intergenic
1062341932 9:136097565-136097587 GGGCTGAGTGGGGCTCACCCCGG + Intergenic
1062399204 9:136365107-136365129 CGGCTGGGAGGACCCCACCCCGG + Intronic
1062644203 9:137538435-137538457 GGGATCAGAGGACACCACCCAGG + Intronic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1190562263 X:51697147-51697169 GTACTGAGTGGATCACACCCAGG + Intergenic
1190744457 X:53313730-53313752 GGGCTGAGTGAACTGCACACAGG + Intronic
1192232821 X:69277814-69277836 GGGCTCAGTGGGCCCCAGCCAGG + Intergenic
1192313163 X:70032859-70032881 GGGCTGAGTGGTTTCCTCCCAGG + Intronic
1192325404 X:70127994-70128016 GGGCTGAGTGAGGCCCAGCCAGG - Intergenic
1196197943 X:112855146-112855168 GGGCTCGGAGGACCCCACGCTGG - Intergenic
1196855626 X:119980560-119980582 GGGCTCAGTGTACTCCAGCCTGG + Intergenic
1198074196 X:133179314-133179336 AGGCTGTGAGCACCCCACCCAGG + Intergenic
1200249796 X:154546900-154546922 GGGCTGAGCGGACCCGCCTCAGG + Exonic