ID: 1127878518

View in Genome Browser
Species Human (GRCh38)
Location 15:63133988-63134010
Sequence AGTTGTGTCAAATGTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127878518 Original CRISPR AGTTGTGTCAAATGTTAGGA GGG Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
901357660 1:8665241-8665263 AGTTGTGGAAAATGCTATGAAGG - Intronic
902889986 1:19435903-19435925 AGTTGAGTCACAAGTGAGGAAGG + Intronic
904379152 1:30099758-30099780 GGATGTGTCAAAAGTTGGGATGG - Intergenic
904570117 1:31457668-31457690 AGTTGTGAAAAATGTTATAAAGG - Intergenic
904750152 1:32736959-32736981 GGTTGTTTGAAATGTTAAGACGG + Intergenic
907893914 1:58665693-58665715 AGATGTTTAAAATGTTAGTATGG - Intronic
907911315 1:58829105-58829127 AGTTGAGGGAACTGTTAGGATGG + Intergenic
908016766 1:59847914-59847936 AGTTGAGTCAAATACTTGGAAGG + Intronic
908680345 1:66653694-66653716 CATTGTATAAAATGTTAGGATGG + Intronic
909423851 1:75498387-75498409 AGTAATATCAAATTTTAGGAAGG - Intronic
909859598 1:80588297-80588319 ATTTGTGGTAAATGTTTGGATGG + Intergenic
910469100 1:87531646-87531668 ACTTGTGTCAAGTGTTGGGAAGG - Intergenic
911480565 1:98434837-98434859 AGCTGTGTCTAAAGTTAGGATGG - Intergenic
911589713 1:99732807-99732829 AGTTTTGCCAAAGGTTTGGAGGG + Intronic
911867156 1:103043320-103043342 ATGTGTGTCACATGTCAGGAAGG + Intronic
912178008 1:107184378-107184400 AGTTGTGTCAGATGCTGGGAAGG - Intronic
913197000 1:116465434-116465456 AGTTGTCTAAAATGTCAGAATGG + Intergenic
915097599 1:153474404-153474426 AGGTCTGTCAAAGGTGAGGAAGG - Intergenic
918900595 1:190411671-190411693 ATTTTAGTGAAATGTTAGGAGGG - Intronic
921618799 1:217303491-217303513 AGTTGTATAAAATGATAGGCTGG + Intergenic
922647617 1:227305633-227305655 AGTGGTGTCAAATTTGATGATGG - Intronic
1064570703 10:16689962-16689984 AGGTTTGACAAATGTTAGGCTGG - Intronic
1068948973 10:62758531-62758553 AGTAGTGTCAAATCTTAGCTTGG - Intergenic
1070382995 10:75898399-75898421 AGCAGTGTCAAATGCTGGGACGG - Intronic
1071262713 10:83935329-83935351 ACTTGTGCCAAATGTAAGCAAGG + Intergenic
1073370869 10:102987806-102987828 AGTTGTGTGAAATGTGGGGCAGG + Intronic
1075233728 10:120708178-120708200 ACTGGTTTCAAATGTTTGGAGGG + Intergenic
1076514598 10:131036830-131036852 TGGTGAGTGAAATGTTAGGACGG - Intergenic
1079932228 11:26578516-26578538 ATTTGTTTCAAAAGTTGGGAAGG + Intronic
1082988566 11:59187913-59187935 AGTGGTTCCAAATGTTAGGCTGG + Intronic
1083091951 11:60208949-60208971 AGTGCTTTAAAATGTTAGGAAGG + Intronic
1085632274 11:78128384-78128406 GGTTGTGTAAAATGTTGGAAAGG - Intronic
1085779608 11:79396446-79396468 TGTTGTCTCAACTTTTAGGAGGG - Intronic
1086760093 11:90618908-90618930 AGTTGGATCAAATATTAGAAAGG - Intergenic
1087077201 11:94136384-94136406 AGTTATGGTAAATGTTAGGAAGG - Intronic
1088075916 11:105848371-105848393 TGTTGTGCCAAAAATTAGGAAGG - Intronic
1088559512 11:111098374-111098396 AGTTGTGTGAGGTGTAAGGAAGG - Intergenic
1088904696 11:114145961-114145983 AATTGTGTTAAATGTTATAAAGG + Intronic
1090097998 11:123762832-123762854 AGGTGTGTCACATGGTAAGAGGG + Intergenic
1095333499 12:40998328-40998350 AGTTGGGGAAAATGTTTGGATGG - Intronic
1098358661 12:69634419-69634441 AGTTGTGACTAATGCTAGTAAGG - Intergenic
1100960340 12:99955939-99955961 AGTTCTGTCAATTCTGAGGAAGG - Intronic
1104076365 12:125393389-125393411 AGTTGTGGTAAATATGAGGAAGG + Intronic
1104881979 12:132078230-132078252 AGTTAAGTCATATTTTAGGAGGG - Exonic
1105466538 13:20647135-20647157 AGTAGAGAGAAATGTTAGGAAGG - Intronic
1115385520 14:32791791-32791813 TTTTGTGTAAAATGTAAGGAAGG + Intronic
1115764090 14:36604873-36604895 AGTTGTGTCATATGTTTGGCAGG - Intergenic
1115848679 14:37568853-37568875 AGTTGTACCATATGATAGGAAGG + Intergenic
1116352583 14:43884148-43884170 AGTTGTGGGAAATGTTTAGAAGG + Intergenic
1116377566 14:44223427-44223449 AGTTATGTTAAATGTTAATATGG + Intergenic
1117942468 14:60982467-60982489 AGTAGTGTTAAATGTTTGGACGG - Intronic
1118898509 14:69967010-69967032 TCTTGTGTCCAATGTGAGGAAGG - Intronic
1125122788 15:36182598-36182620 AGTTTTGTCTAATGCTTGGAAGG + Intergenic
1126917493 15:53482301-53482323 AGTAGTGTCAAGTGTGGGGAAGG + Intergenic
1127394775 15:58535819-58535841 AGCTGCCTCAAATGTTAAGAGGG - Intronic
1127878518 15:63133988-63134010 AGTTGTGTCAAATGTTAGGAGGG + Intronic
1129011736 15:72424606-72424628 AATTGTGTTAAATGCTAAGAAGG + Intergenic
1131502506 15:92982689-92982711 AATTGTGTGAAGTGTTTGGAAGG + Intronic
1135557629 16:23450350-23450372 AGTTGTGAGAACTGTCAGGAGGG - Intronic
1138371161 16:56527465-56527487 TCTTGTGGCAAATGTTAGCAGGG + Intergenic
1138722965 16:59103452-59103474 AGATGAGTCAAATGTAAAGAAGG + Intergenic
1139416911 16:66820054-66820076 AGTGGTGTCAACTGATGGGAGGG - Intronic
1144445622 17:15325104-15325126 AATTGTGTCCATTGTTAGGCAGG + Intronic
1148583181 17:48757744-48757766 AGTTTTGCAAATTGTTAGGAAGG - Intergenic
1150073397 17:62171659-62171681 TGTTGTGTCAGCTGTGAGGAAGG + Intergenic
1151642814 17:75408527-75408549 GGTTGTGACAAATTTCAGGAAGG + Intergenic
1153533473 18:6074357-6074379 AGTTTTGTAAAATGTTATGTGGG + Intronic
1153924322 18:9821913-9821935 ATTTTTGTCAAATCTTAGCAAGG + Intronic
1155053719 18:22168537-22168559 AGTTGTGATAACTGTTTGGAGGG + Intergenic
1155058697 18:22208719-22208741 AGTTTTGTATAATATTAGGAAGG + Intergenic
1155609340 18:27646415-27646437 AGAGGTTTCAAATATTAGGAGGG + Intergenic
1157943154 18:51951162-51951184 AAGTGTGTCAAAAGTTAGGCTGG - Intergenic
1158659773 18:59376208-59376230 AGGCCTATCAAATGTTAGGAAGG + Intergenic
1164862209 19:31570607-31570629 AGTTGTGTAAAATGGTCAGATGG - Intergenic
926556680 2:14365712-14365734 AGTTGTGTCAAAGGTAAAAATGG - Intergenic
926576547 2:14588666-14588688 AGCTGTCTCAGATGTTAGGGTGG + Intergenic
926604032 2:14878367-14878389 AGTTGTGCCAAATTAAAGGAAGG + Intergenic
931589623 2:63868292-63868314 ATTTGGGTGAAATTTTAGGAAGG + Intronic
932300174 2:70661440-70661462 GATTGGGTCAAATTTTAGGAGGG - Exonic
932983278 2:76696797-76696819 AGTTGTTTCCACTGGTAGGACGG - Intergenic
933036364 2:77404035-77404057 AGTTGTGTTAAATGTCAAGATGG - Intronic
936678583 2:114744453-114744475 ATTTGTATCAGAAGTTAGGATGG + Intronic
941229029 2:162885704-162885726 AGTCATGTCAAATGTTTGGCAGG + Intergenic
941388793 2:164885972-164885994 AATTTTATCAAATGTTAGGTAGG + Intergenic
944280962 2:197896585-197896607 AGATGTGTAAAATGTGAGAATGG + Intronic
944702278 2:202256880-202256902 ATTTGTGTCAAATTTGAGGAAGG + Intergenic
945149014 2:206768315-206768337 AATGGTGCCAAATGTAAGGAAGG + Intronic
945206527 2:207338480-207338502 AGATGTGTTAAATGTAAAGATGG - Intergenic
947858135 2:233338348-233338370 AGTTTTGGCAAGTGGTAGGAGGG + Intronic
1172177636 20:32982227-32982249 AGTTGTGTGCATTGTTGGGAAGG - Intergenic
1177322591 21:19542513-19542535 TGTTTTGTCAAATGTTGTGAAGG - Intergenic
1178179766 21:30146378-30146400 AATTAGGTAAAATGTTAGGAAGG + Intergenic
1181553440 22:23653935-23653957 AGTTGTGTCATCAATTAGGATGG - Intergenic
951025997 3:17830841-17830863 AGTTGTGCTACATGTTATGATGG + Intronic
952981996 3:38743601-38743623 AATTCTGTCAAATGTTATAAGGG - Intronic
953832833 3:46316587-46316609 GGTTGTGACAAAAGTTAGGTAGG - Intergenic
954543542 3:51413298-51413320 AGTTGCATTAAATGTTCGGAAGG + Exonic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
957110132 3:75944642-75944664 TGTTTTCTCAAAAGTTAGGAAGG + Intronic
959187645 3:103066548-103066570 AGTTGTGTGTAATTTAAGGAGGG - Intergenic
959329613 3:104986762-104986784 AGTTGTGTCAAGAATGAGGATGG - Intergenic
959558405 3:107750332-107750354 AGTTGTTTCAAAATATAGGAAGG + Intronic
961415944 3:126756810-126756832 AGTTGTATGGAATGTAAGGATGG + Intronic
962766365 3:138567269-138567291 AGTTGTTTCCAATTTTAGAATGG - Intronic
962969072 3:140382174-140382196 AACTGTGTTAAATGTTAGGATGG - Intronic
963278559 3:143357987-143358009 AATTCTGTCAAGTTTTAGGAGGG + Intronic
965691560 3:171362420-171362442 ATTTGTATTAAATATTAGGATGG - Intronic
967266152 3:187694107-187694129 AGTTTTGTCCAATGGCAGGAGGG + Intergenic
967764935 3:193268924-193268946 AGAGGTGTCAAATGGTAGCAGGG - Intronic
968204558 3:196787738-196787760 AGATGTGTGGAATGTTTGGAGGG + Intronic
970373912 4:15436814-15436836 AGTTGGGACAAAAGATAGGAAGG + Intronic
971140434 4:23919450-23919472 AGATGTGTAAAATCATAGGATGG - Intergenic
971179422 4:24315105-24315127 AGAACTGTCAAATGTTAAGATGG - Intergenic
972681403 4:41310105-41310127 AGATGTGTCACATGTTTAGAGGG - Intergenic
976842874 4:89452220-89452242 AGTTGTTTCAAATGTTCTGATGG + Intergenic
978824905 4:113010606-113010628 GGTTGTGATAAATGCTAGGAAGG + Intronic
979466939 4:121050749-121050771 ACTTGTGCCAAATGTGAAGAAGG - Intronic
981959266 4:150515759-150515781 ATTTGTGTCAAATGCTAAAATGG - Intronic
985035243 4:185832482-185832504 ATTTGTGTCAAATGAGAGTATGG + Intronic
989750713 5:44889597-44889619 AGTTGTGCCAACTACTAGGAAGG + Intergenic
990376347 5:55174053-55174075 AGTTGTGCCATATGGCAGGAGGG + Intergenic
990462493 5:56042371-56042393 AGTTTTGTCAAATATTGTGAGGG - Intergenic
990910442 5:60846258-60846280 AGTTGTGTTAAATGTTAAAGTGG + Intergenic
993450177 5:88063231-88063253 TGTTGTCTCAAATGTCATGAAGG - Intergenic
998892368 5:146759952-146759974 AGTTGTGTCATAGGATGGGAAGG - Intronic
999123821 5:149231285-149231307 TGTTCTGACAAATGTCAGGAAGG + Intronic
1000895871 5:166854757-166854779 AGTTGTGTTAAATGTGAAAAAGG + Intergenic
1001135413 5:169098670-169098692 AAATGTGTCAAATGACAGGAGGG + Intronic
1001926530 5:175640912-175640934 AGAAGTGTCAAATGTGATGAGGG - Intergenic
1002808964 6:606916-606938 ATTTTTGTAAAATGTCAGGAGGG + Intronic
1003636525 6:7836537-7836559 AGTTATGTAAAATGTTACTATGG + Intronic
1003691881 6:8362888-8362910 ATTTGTGTATAATGTTATGAGGG - Intergenic
1003935953 6:10975615-10975637 TGATGTGGCAGATGTTAGGATGG + Intronic
1004661239 6:17711540-17711562 AACTGTCTTAAATGTTAGGATGG - Intergenic
1005365219 6:25069807-25069829 AGTTGTCTCCATTTTTAGGAAGG - Intergenic
1007828616 6:44620843-44620865 ACTTGTGTCAACTGTCGGGATGG - Intergenic
1008473881 6:51915355-51915377 AGTTGTGTTAAGTGTGAGAAAGG - Intronic
1009615733 6:66003305-66003327 AATTATGTCAAAGGGTAGGAGGG - Intergenic
1009850231 6:69187753-69187775 AGCTCTGTCAAAAGTTGGGAAGG - Intronic
1014522554 6:122462428-122462450 AGTTGTGTTATATGTGAAGAGGG - Intronic
1015132255 6:129826095-129826117 GGTTCTGTCAAATGATAGTAAGG + Intergenic
1019747195 7:2707560-2707582 AGTTGTGTAACTTGTTAGCATGG - Intronic
1021835695 7:24671708-24671730 TTTTGTGTCAAATGTGAGGAGGG + Intronic
1022196493 7:28072719-28072741 AGTTGTTTCAAAAGTTGGGATGG + Intronic
1024188457 7:46980234-46980256 AGATGTTTCAAATGTCTGGATGG - Intergenic
1024639829 7:51319418-51319440 ACTTGTGTCAACTGTGGGGAGGG + Intergenic
1025941887 7:66081149-66081171 GGTTGTGTCAACAATTAGGATGG + Intronic
1025955729 7:66181384-66181406 ATATGTATCAAATGTTATGATGG + Intergenic
1028249283 7:88521966-88521988 AGTTTCATCAAATGTTAAGAAGG + Intergenic
1028629259 7:92916037-92916059 AAATGTATGAAATGTTAGGAAGG + Intergenic
1030009259 7:105149841-105149863 AGTTGTTTTAAATGTTTGTAGGG - Intronic
1030755398 7:113281976-113281998 AATTGTGGTAAATGTTATGAAGG + Intergenic
1032378875 7:131454696-131454718 AATTGTGTCACATGGGAGGAAGG - Intronic
1033381386 7:140823118-140823140 AGTTATGTAAAACGTTAGGCTGG - Intronic
1037135207 8:15451803-15451825 AGTTGAGTTAAATGGTAGGATGG + Intronic
1039147352 8:34463786-34463808 AGTTTCTTCAAATGTTAAGACGG + Intergenic
1040969608 8:53120485-53120507 AGTTGTATTGAATGTTAAGAAGG + Intergenic
1041361638 8:57060895-57060917 AGTTATGTAACATTTTAGGATGG - Intergenic
1041895889 8:62924349-62924371 AGTTGTGTTAAATGTTGCCAAGG - Intronic
1042219942 8:66463163-66463185 AGTGGTCTCAAATGTTAAGCTGG - Intronic
1046994056 8:120495963-120495985 AGTTGGTTCAAATGTTGGGGGGG - Intronic
1047399913 8:124537711-124537733 AATTATATCAAAGGTTAGGATGG + Intronic
1050233419 9:3552942-3552964 AGAAGTTTCAAATGTTAGGGTGG + Intergenic
1052221121 9:26023864-26023886 AGTTGTGTAAAACGGTAAGAAGG - Intergenic
1055300310 9:74875833-74875855 AGTGGTGACAAAGGTTAGAAAGG + Intronic
1056685525 9:88755821-88755843 AGTGGTGTCCAGTGTTAGGAGGG - Intergenic
1059568693 9:115410697-115410719 AGTGGTGGCAAATTGTAGGAAGG + Intergenic
1060857589 9:126927223-126927245 AGTTGTGTCATAGGAGAGGATGG + Intronic
1203743449 Un_GL000218v1:22252-22274 TGTTTTGTCAAGTGTTTGGAAGG + Intergenic
1185744261 X:2559180-2559202 AGTGTTGACAAATGTTTGGATGG - Intergenic
1190943495 X:55068220-55068242 AGTTGTATAAGATGTAAGGAAGG + Intergenic
1193386451 X:80877968-80877990 ATTTGTATCAATTGTTAGTACGG + Intergenic
1194491725 X:94558986-94559008 TGTTCTATCAGATGTTAGGAGGG - Intergenic
1194911668 X:99652690-99652712 AGTTGTTACATAAGTTAGGAAGG + Intergenic
1195401587 X:104466701-104466723 AGGTGTGTATAATGTTAGGTAGG + Intergenic
1195695843 X:107666752-107666774 AGTTGTGTCTTGTTTTAGGAGGG - Intergenic
1196362686 X:114883935-114883957 AGTCGTGCCAGAGGTTAGGATGG - Intronic
1198786590 X:140295528-140295550 ATTTGTGTTCAATGTTAGGAAGG - Intergenic
1199261209 X:145777940-145777962 AGATTTATCAAATGCTAGGAAGG - Intergenic
1199585770 X:149414360-149414382 AGTTTTGTCAAATTTTATTAGGG + Intergenic