ID: 1127878682

View in Genome Browser
Species Human (GRCh38)
Location 15:63135849-63135871
Sequence CTCTGTGTATAAGGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127878676_1127878682 29 Left 1127878676 15:63135797-63135819 CCTTACTATGATTTAGATCTAGA 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG 0: 1
1: 0
2: 3
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127878682 Original CRISPR CTCTGTGTATAAGGGGGAGA AGG Intronic
901718381 1:11175291-11175313 ATCTGGGTATCAGGGGCAGAAGG + Intronic
903486187 1:23690849-23690871 CTATGTGTATAAGGTGTATATGG + Intergenic
904416926 1:30368673-30368695 CTCTCTCTATAAGGGGGATTTGG + Intergenic
905183546 1:36180479-36180501 ATATGTGTGTATGGGGGAGAAGG - Exonic
905239936 1:36575050-36575072 CCATGTGTATAAGGGGGAGTTGG - Intergenic
906716824 1:47976257-47976279 CCCAGTGTGTAAGGGGTAGAAGG - Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
908457314 1:64316254-64316276 TTCTGTGTAGAAAGGGCAGAGGG + Intergenic
909389050 1:75096701-75096723 CTTTAGGTATAAAGGGGAGAGGG - Intergenic
910468514 1:87525755-87525777 CTCAGTGTATGTGAGGGAGAGGG + Intergenic
910500443 1:87883955-87883977 CTCTGTGTAAAGGGGTCAGAGGG + Intergenic
911219395 1:95231526-95231548 TTGTGTGTGTAAGGGTGAGAAGG + Intronic
911221298 1:95250248-95250270 CTGTGTGTGAAATGGGGAGAGGG + Intergenic
913401781 1:118442838-118442860 TTTTGTGTATAAGGGCGAAAAGG + Intergenic
914453578 1:147814952-147814974 CTCTCAGTATAAGGAAGAGAAGG + Intergenic
922860381 1:228811189-228811211 GTCTGTGTATAAGGAAGGGATGG + Intergenic
923158073 1:231295870-231295892 CTCTGTGTATAAGGCTGGGAGGG - Intergenic
1064445971 10:15393224-15393246 CTCTGTGCATCTGGGGGAGGAGG + Intergenic
1065216766 10:23456620-23456642 CTCTCTGTACCAGGAGGAGAAGG - Intergenic
1068738113 10:60437683-60437705 CAGTGTGCATAAGGGGGAGAGGG + Intronic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1070461332 10:76673574-76673596 GTCTGTGTATTAAAGGGAGAGGG + Intergenic
1070467770 10:76741702-76741724 CTCTGTGAATGAGGAGGTGAGGG + Intergenic
1070775721 10:79108648-79108670 CTGTGTGTATTAGGGGGTGATGG - Intronic
1072817741 10:98526217-98526239 CTCTGGGTATAATGGTTAGAAGG + Intronic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1073734838 10:106334111-106334133 CTCTGTGTTTAAGAGGAAAAAGG - Intergenic
1073832574 10:107402807-107402829 CTCTATTTGTAAGGGGAAGAAGG - Intergenic
1074538385 10:114345190-114345212 CTCTGTGTATCGGGGGAACATGG + Intronic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1075016838 10:118915893-118915915 CCCTGTGTTGAAGGGGCAGAAGG - Intergenic
1076140034 10:128071271-128071293 CCCTCTGTGTAAGGGGGAGGCGG - Intronic
1076192529 10:128492686-128492708 CTCTGTGGAGAAGGGGGAAAAGG + Intergenic
1076514744 10:131037630-131037652 CTTTGTGGATAAAAGGGAGAAGG - Intergenic
1078293480 11:10040730-10040752 GTGTGTGTGTATGGGGGAGATGG + Intronic
1079161557 11:17999652-17999674 GTCTGTGTGTGAGGGGGACAGGG - Intronic
1080152171 11:29065129-29065151 CTATGTGTGTAAAGGGGAGTGGG + Intergenic
1080338744 11:31231665-31231687 ATCTGTGTTTATGGAGGAGAAGG - Intronic
1083079044 11:60072403-60072425 TTCAGTGTATAATGGGCAGATGG + Intergenic
1085372250 11:76020068-76020090 CTCTGCGTATAATAAGGAGAGGG - Intronic
1088987079 11:114918572-114918594 CTCTTTGGAGAAGGGGAAGATGG + Intergenic
1089270818 11:117300256-117300278 GTGTGTGTGTAAGGTGGAGAGGG - Intronic
1089677836 11:120102202-120102224 CTGTGTGTATGAGTGGGGGATGG - Intergenic
1090229974 11:125095205-125095227 CACTGTTTAGAAGGTGGAGAGGG - Intergenic
1090836618 11:130458738-130458760 CTCCCTGTGTAAGAGGGAGAGGG - Intronic
1091037103 11:132244172-132244194 CTCAGTGTAGAAGGGAGGGATGG + Intronic
1098590698 12:72208175-72208197 GTGTGTGTATAAAGGGCAGAGGG - Intronic
1101040679 12:100752359-100752381 GTGTGTGTGTAAGAGGGAGAGGG - Intronic
1102061524 12:109935752-109935774 CTCTGTGTAGCAGGAGGAAAGGG - Intronic
1103176867 12:118871824-118871846 CTCTGTCTAAAAGGAGGAGGAGG - Intergenic
1103964099 12:124627156-124627178 CTCTGTGTCGATGGGGGTGATGG - Intergenic
1107812248 13:44211741-44211763 CCCTGAGTAAAAGAGGGAGATGG + Intergenic
1108026045 13:46178922-46178944 TTCTGTGTATACAGGAGAGATGG - Intronic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1119762801 14:77164324-77164346 TTCTGTGTATATGGGCGATAGGG - Intronic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1126097839 15:45101804-45101826 CTCTGTGTCAAAGGTGGAGGTGG - Exonic
1126105015 15:45141788-45141810 TTCTGTGTGTGAGGGAGAGATGG + Intronic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1129759337 15:78120474-78120496 CTCTGTGTACCAAGGGGACAAGG + Intronic
1130567605 15:85010451-85010473 TTCTGTGTGTAAGGAAGAGAGGG - Intronic
1132253112 15:100349631-100349653 CTCTGTCTATAGGTGGAAGAAGG + Intergenic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1134082301 16:11333553-11333575 CTCTGTGTAGAAGGGGGACCCGG - Intronic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135663717 16:24318087-24318109 CTTTGTGAATATGGGAGAGATGG - Intronic
1136291152 16:29272200-29272222 CTCTGTAGGCAAGGGGGAGAAGG - Intergenic
1137249918 16:46733745-46733767 CTATGTGTGTTAGGGGGTGAGGG + Intronic
1138273447 16:55712742-55712764 CTCTCAGTCTAATGGGGAGAGGG + Intergenic
1138530700 16:57632806-57632828 CTCTCTGCATTAGTGGGAGATGG + Intronic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1140402860 16:74685657-74685679 CTCTGTGTATGTGGGGGCGGGGG + Intronic
1142097016 16:88245661-88245683 CTCTGTAGGCAAGGGGGAGAAGG - Intergenic
1142804703 17:2365256-2365278 CTCCGTGGATATGGAGGAGATGG + Exonic
1143387807 17:6542448-6542470 CTTTGTGTGTGAGGGAGAGAGGG - Intronic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1146912390 17:36657142-36657164 TTCTGTGGAAAAGGGGGAGCCGG - Intergenic
1147004202 17:37388655-37388677 ATCTGTGTCTAAAGGAGAGAGGG - Exonic
1147389411 17:40099990-40100012 CTCTTTTTATAAGGCGTAGATGG + Intronic
1148244930 17:46024488-46024510 CTCCATGTAGAAGAGGGAGAAGG + Exonic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1149397792 17:56262450-56262472 CTCTGTTTTTAAGGGTGAGATGG + Intronic
1152320695 17:79607617-79607639 ATCTGCGTATATGGGGGAGGGGG + Intergenic
1152365149 17:79851240-79851262 CAGAGTGTATAAGGGAGAGAGGG - Intergenic
1154111117 18:11569325-11569347 CCCTGTGTACCAGTGGGAGATGG - Intergenic
1156383587 18:36586004-36586026 CTCTTTGGAGTAGGGGGAGAAGG - Intronic
1156883194 18:42104781-42104803 CTCTGTGTATATGTGAGAGCAGG - Intergenic
1157182983 18:45513903-45513925 CTCTGTGTGTTGGGTGGAGAAGG - Intronic
1158043699 18:53129486-53129508 GTATGTGTATATGAGGGAGAGGG - Intronic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1158911945 18:62073195-62073217 GTGTGTGTGTAAGGGGGGGATGG + Intronic
1159107178 18:64015906-64015928 CTCTTTTTATTAGGAGGAGAAGG - Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160130348 18:76219634-76219656 CTCTGTTTAGAAGGGAGAGGTGG + Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1164480727 19:28609238-28609260 CTTTTTGGATAAGGGGGTGACGG - Intergenic
1165454174 19:35901150-35901172 GTCTGTGTCTAAGGGGGTGCTGG + Intronic
1165856224 19:38880618-38880640 CTCTGAGGAAAAGGGTGAGAGGG + Intronic
1166423515 19:42656063-42656085 CTCTGAGTCTCAGGTGGAGAAGG - Intronic
1166956750 19:46470132-46470154 CTGTGTGAATAAGGAGGAGTTGG - Exonic
1167310162 19:48732806-48732828 GACTGTGTATATGGGTGAGAAGG - Intronic
1167596377 19:50430412-50430434 TTCTGTGAAAAAGGGAGAGAAGG + Exonic
1168343964 19:55641479-55641501 CGCTGTGTGTAACAGGGAGAGGG + Intronic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
926669236 2:15560847-15560869 CTCTCTGTATTAGGAGGGGAAGG - Intronic
926669242 2:15560884-15560906 CTCTCTGTATTGGGAGGAGAGGG - Intronic
927882678 2:26699701-26699723 CCCTGTGTCCAAGGTGGAGAGGG - Intronic
930795210 2:55382561-55382583 CCCTGTGAATAAGGGAGAGATGG - Intronic
931699352 2:64897369-64897391 CTTTTTGGATAAGGGGGTGACGG + Intergenic
932106334 2:68946316-68946338 CCCTTTGTATAAGGGGGAAGTGG - Exonic
933187846 2:79298674-79298696 ATCAGTGTCTAAGGGGGAGTTGG - Intronic
933987155 2:87601721-87601743 CTCTGTGTGGAAGGAGGAGGTGG + Intergenic
935861697 2:107337906-107337928 CTCTGTGGGAAAGGGGGAGGTGG + Intergenic
936306686 2:111349087-111349109 CTCTGTGTGGAAGGAGGAGGTGG - Intergenic
939520230 2:143221304-143221326 CTCTGAATATAAGCAGGAGATGG + Intronic
940400346 2:153241792-153241814 TTCTTTCTATAAGGGGGAGAGGG - Intergenic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941225189 2:162839050-162839072 GTGTGTGTGTTAGGGGGAGAGGG - Intergenic
942935734 2:181554559-181554581 CTCTGATTAAAAGGGGGAGGGGG - Intronic
943572749 2:189593202-189593224 CTTTGGGGATAAGGGGGAGAGGG + Intergenic
945515377 2:210757885-210757907 CTGTGTTTAAAAGGGAGAGAAGG - Intergenic
946879699 2:224164510-224164532 CTCTGTGCAGGAGTGGGAGATGG - Intergenic
1172555741 20:35839530-35839552 CTCTCTGTAAAATGGGGAGAAGG - Intronic
1175238517 20:57529056-57529078 CCCTGGGGATAAGGAGGAGATGG - Intergenic
1176958038 21:15128796-15128818 CTCTTTGTAAAATGGGGATATGG + Intergenic
1178275136 21:31230145-31230167 CTCTGTGAGTTAGGGGGTGAGGG - Intronic
1178298511 21:31431119-31431141 TCCAGTGGATAAGGGGGAGAAGG - Intronic
1178523427 21:33304655-33304677 CTCTGTGTATACTTGGGAGCTGG - Intergenic
1179353892 21:40640588-40640610 ATGTGTGTATAAGTGAGAGATGG + Intronic
1181322749 22:22021264-22021286 CTCTGTCTGTTGGGGGGAGATGG - Intergenic
1181972995 22:26707337-26707359 CTGTGTGTATAATGGTGAGTGGG + Intergenic
1182062536 22:27408147-27408169 CTTTGTGGCTATGGGGGAGAGGG - Intergenic
1182929668 22:34160547-34160569 CTCTGTGTTTCAGTGGGAGTTGG + Intergenic
1183519009 22:38285495-38285517 CTGTGTGTGTATGGGGGAGCGGG + Intergenic
1184158465 22:42684219-42684241 TTCTGTGCAGAAGAGGGAGAGGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949697360 3:6714547-6714569 CTCTGTGTATAAAGGAGAATGGG + Intergenic
950204055 3:11064411-11064433 CTCTCCATATAAGGAGGAGAAGG - Intergenic
951066720 3:18275653-18275675 CTCTCTGTATAAAATGGAGATGG - Intronic
951284116 3:20788512-20788534 CTCTGTGGACAAAGGGGAGGTGG - Intergenic
951481136 3:23163627-23163649 CTCTGGGAAGAAGCGGGAGAGGG - Intergenic
951656526 3:25015100-25015122 GTCTGTGTATAAGATGAAGATGG + Intergenic
953067872 3:39491232-39491254 CACTGTTTATACAGGGGAGATGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955763858 3:62319180-62319202 CTTTGGGTATAAGCGGGAGTTGG + Exonic
958922514 3:100122670-100122692 CATTTTGAATAAGGGGGAGAGGG - Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960262162 3:115580307-115580329 CTCAGTGTAGAAGGTGTAGACGG - Intergenic
960446312 3:117753099-117753121 CTCAGTGTACAAGGGGGTGTAGG + Intergenic
962866927 3:139454776-139454798 GTGTGTGCAAAAGGGGGAGAAGG - Exonic
965544415 3:169900869-169900891 ATCTGTATATAAGGTGGAGCTGG - Intergenic
967081541 3:186054339-186054361 CTCTCTCTTTAAAGGGGAGAAGG - Intronic
970820717 4:20208969-20208991 CTCTGTCTATAAAGCAGAGATGG + Intergenic
975766652 4:77675451-77675473 CTCTGTGATTATGGAGGAGATGG + Intergenic
978538190 4:109785624-109785646 CTCTGTGTATATGGGTGATATGG + Intronic
981342760 4:143641077-143641099 CTATGTGTATAAGGAAGAAAAGG - Intronic
982547393 4:156751325-156751347 GTCTGTGGATAAAGGGTAGAGGG + Intergenic
984589367 4:181600393-181600415 CTCTGGGTATAAGGAGGACTGGG - Intergenic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
989052725 5:37337102-37337124 CCCAGTGTATAAGGAGGTGAGGG - Intronic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
992519450 5:77535263-77535285 TTCTGTGCAGAAGGGGAAGATGG - Intronic
994170567 5:96655356-96655378 TTCTGTGGATAAGAGGGAAAAGG + Intronic
996540939 5:124629652-124629674 CTCTGTCTATAAGTGGGAGAGGG + Intergenic
996763501 5:127010651-127010673 CTCTGTATTTAAGCTGGAGATGG + Intronic
996937646 5:128966437-128966459 CTCTCTGAAAAAGGGGGACACGG + Exonic
997655117 5:135548719-135548741 CTCTGTGGGGAAGGTGGAGAAGG + Intergenic
1001362066 5:171096845-171096867 CTCTGTGAAGAAGGGGTGGAGGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1010047514 6:71463609-71463631 CTCTATGTAACAGGGTGAGATGG + Intergenic
1010731595 6:79396987-79397009 CTGTGTGTGTAAGGAGAAGAGGG + Intergenic
1012616036 6:101281333-101281355 TTGAGTGTATAAGTGGGAGAAGG + Intergenic
1014432480 6:121387586-121387608 CTCTGTGTTTCAGGGAGGGATGG + Intergenic
1015185118 6:130407153-130407175 CTATGTGAATGAGGGGGTGAGGG + Intronic
1015544768 6:134350391-134350413 CTCTATGTATAAGATGGAAAAGG - Intergenic
1017424810 6:154309473-154309495 CTCTGTGAAGAACGGTGAGATGG - Intronic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1020361263 7:7329172-7329194 CTGAGTGTATACGGGGGCGACGG - Intergenic
1021580695 7:22149650-22149672 CTCTGTGTAGAACGGGGTCATGG - Intronic
1021838144 7:24700936-24700958 TTCTAGGTATAAGGGGGAAACGG + Intronic
1021905641 7:25330380-25330402 CTCTGTGGGTAAGGCAGAGAGGG - Intergenic
1022876078 7:34531801-34531823 CTCTGTGTGTATGGTGGAAAGGG + Intergenic
1023808113 7:43889429-43889451 GTCTGTGTATCAGGCGGAGTCGG + Intronic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1024714732 7:52064701-52064723 CTCTCTGTACCAGGGAGAGAAGG + Intergenic
1026383349 7:69821143-69821165 CTGTGTGTATACTGGAGAGAGGG + Intronic
1030416139 7:109245859-109245881 CTGTGTGTGAATGGGGGAGAGGG - Intergenic
1031869460 7:127076353-127076375 CTCAGAGTATCTGGGGGAGAAGG + Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035650026 8:1257197-1257219 CTCTGTGGGTGAGCGGGAGAGGG - Intergenic
1036420975 8:8595117-8595139 ACCTGTGTATGAGGGTGAGAGGG - Intergenic
1036686820 8:10917301-10917323 CCCTGTGTTAAATGGGGAGAGGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039033459 8:33333673-33333695 CACTGAATATAAGGAGGAGAGGG + Intergenic
1039811835 8:41056089-41056111 CTCTGTGTGTATGGGGGTGTTGG - Intergenic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1042860557 8:73309058-73309080 GTATGTGGGTAAGGGGGAGATGG - Intronic
1045474522 8:102541795-102541817 CTCTGTGTATGTGTGGGAGGAGG + Intergenic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1046728920 8:117704177-117704199 CTCTGAGTATAAGTGGGCAAAGG - Intergenic
1052620750 9:30906038-30906060 ATGTGTGTATAGGGAGGAGAGGG + Intergenic
1053333438 9:37238265-37238287 CTCTTTGCATGAGGTGGAGAAGG - Intronic
1054715948 9:68557833-68557855 TTCAGTGAATAAGGGGGAGTTGG - Intergenic
1054756644 9:68965576-68965598 CTTTGTGTTTAAGGATGAGAAGG + Intronic
1055833361 9:80409265-80409287 CTCTTTGTATCAGGCAGAGAAGG + Intergenic
1059476293 9:114550624-114550646 ATCTCTGTAGAAGAGGGAGAAGG - Intergenic
1059685230 9:116628811-116628833 CTATGTGTATATGGGGTAGAGGG + Intronic
1059784525 9:117566042-117566064 CTCTGTAAATAACGGAGAGAAGG + Intergenic
1060423033 9:123483166-123483188 CTCAGTGTAGTAGGGGGAGGTGG - Intronic
1187217941 X:17295279-17295301 CTCTGTGTATGAAGTGGACAAGG + Intergenic
1187783292 X:22854281-22854303 CTCTATGTATTGGGAGGAGAGGG + Intergenic
1190331089 X:49235814-49235836 GTGTGTGTGTAAGGGGGTGAGGG - Intronic
1191711240 X:64151957-64151979 CTCAGAGGAAAAGGGGGAGAGGG + Intergenic
1194067338 X:89277477-89277499 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1200721496 Y:6611691-6611713 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1202258485 Y:22944543-22944565 TTCTGTGTATAATGGAGACAGGG - Intergenic
1202411474 Y:24578301-24578323 TTCTGTGTATAATGGAGACAGGG - Intergenic
1202459308 Y:25091771-25091793 TTCTGTGTATAATGGAGACAGGG + Intergenic