ID: 1127878743

View in Genome Browser
Species Human (GRCh38)
Location 15:63136584-63136606
Sequence ATTTGATACAGTATCTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127878741_1127878743 15 Left 1127878741 15:63136546-63136568 CCTAGGAAAATGTTTTGTCTGTT 0: 1
1: 0
2: 4
3: 39
4: 591
Right 1127878743 15:63136584-63136606 ATTTGATACAGTATCTATTTGGG 0: 1
1: 1
2: 4
3: 29
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127878743 Original CRISPR ATTTGATACAGTATCTATTT GGG Intronic
900710809 1:4112415-4112437 ATTTGAAACAGTCTCTCTTTGGG + Intergenic
901727387 1:11252786-11252808 AGTTGATTCAGGATATATTTGGG - Intronic
904015003 1:27412810-27412832 ATTTGATACAAAAGCTATTAGGG + Intronic
907871067 1:58443316-58443338 TTTTGTTACATTAACTATTTAGG - Intronic
908295659 1:62710231-62710253 TTTATATACATTATCTATTTAGG - Intergenic
909500131 1:76325267-76325289 ATTTAATACAATAAATATTTTGG + Intronic
909706571 1:78591920-78591942 ATTTAATACTATAACTATTTAGG + Intergenic
910182335 1:84498764-84498786 ATTATATACAGAATGTATTTTGG - Intronic
911340246 1:96627689-96627711 ATTTGATGCAGTAATTGTTTGGG + Intergenic
911562950 1:99428856-99428878 ATTTCTTTCAGTATTTATTTAGG - Intergenic
911871063 1:103099997-103100019 CATTGATATAGTAACTATTTAGG - Intronic
911945969 1:104109165-104109187 ATTTGATACTGTCAGTATTTTGG + Intergenic
912070452 1:105802536-105802558 AGTTGCTACAGTATGTATTAAGG + Intergenic
912184891 1:107263417-107263439 ATTTTATACTCTTTCTATTTAGG + Intronic
913930443 1:124955409-124955431 TTTTGAAACAGTCTCTTTTTAGG - Intergenic
913932483 1:124992638-124992660 TTTTGATACAGTCTCTTTGTAGG - Intergenic
916834733 1:168532206-168532228 ACTTGATGAAGTATATATTTTGG + Intergenic
917619166 1:176778167-176778189 ATTTAATAAAGTTTCTATTTTGG - Intronic
917761549 1:178164705-178164727 AGTTGATAAATTACCTATTTTGG + Intronic
918411816 1:184267049-184267071 ATTTGATAAAGTATCTGCTAAGG + Intergenic
918549182 1:185720627-185720649 ATTTTTTAAAGTATTTATTTTGG + Intergenic
918556904 1:185813035-185813057 AGTTGAACAAGTATCTATTTAGG - Intronic
918805651 1:189038870-189038892 ATTGAATACTGTAACTATTTGGG - Intergenic
918862020 1:189840886-189840908 ATTTAATACAGTATTTAGCTAGG - Intergenic
918940959 1:190995904-190995926 ATATAATTCAGTATCTGTTTTGG + Intergenic
919201546 1:194360395-194360417 ATTAGATACGGTCTTTATTTTGG - Intergenic
919284534 1:195538676-195538698 ATTTGAAAAAATATCTATTCAGG - Intergenic
919488833 1:198178905-198178927 ATTTGATTCATTATCTCATTTGG + Intronic
919516284 1:198528643-198528665 ATTTGCAACAATATCTACTTTGG + Intronic
920400716 1:205674584-205674606 TTTTGAAACAGCATCAATTTTGG - Intronic
924233844 1:241984341-241984363 ATTTGACTCAGTATTTATTTAGG - Intergenic
924818473 1:247463947-247463969 CTTTGGTAAAGTATCTATTCAGG + Intergenic
1064913118 10:20425245-20425267 ATTTGGTCCAGTGTCAATTTTGG + Intergenic
1066499647 10:35978498-35978520 ATTTGAACAAGTATTTATTTTGG - Intergenic
1066627488 10:37422390-37422412 ATTTGAACAAGTATTTATTTTGG - Intergenic
1068228130 10:54134002-54134024 ATTTGTTATAATTTCTATTTGGG + Intronic
1068235154 10:54224025-54224047 ATTTGATACTGTATTTTTTGAGG - Intronic
1068300612 10:55133699-55133721 ATCTGATGCCCTATCTATTTTGG + Intronic
1068444397 10:57102747-57102769 ATATGTTAAAGTATATATTTTGG + Intergenic
1069104159 10:64362203-64362225 CTTATATACAGAATCTATTTGGG - Intergenic
1070412247 10:76152719-76152741 GTGTGAAACAGTATCTCTTTTGG + Intronic
1071106150 10:82097903-82097925 CTTTGATAAAGTCTCTGTTTGGG + Intronic
1071316507 10:84405650-84405672 TTTTGATAAAGTGTCTATTCAGG - Intronic
1072066396 10:91875681-91875703 ATTTCTTAAAGTATGTATTTGGG - Intergenic
1073975968 10:109101772-109101794 GTTTTATAAATTATCTATTTTGG + Intergenic
1077801719 11:5545643-5545665 ATTTCAGACAGGTTCTATTTTGG - Intronic
1077944720 11:6883614-6883636 ATTGGATATAGCATATATTTTGG - Intergenic
1078986055 11:16599427-16599449 ATTTTAGACTGTAACTATTTGGG - Intronic
1080413046 11:32044350-32044372 GTTTCATAAAGTTTCTATTTTGG - Intronic
1081144448 11:39544813-39544835 ATTTGATACATCACCTCTTTGGG + Intergenic
1081153798 11:39664344-39664366 ATATGACACAGGATTTATTTTGG - Intergenic
1081803541 11:45876439-45876461 ATTTGAAACAATAGCTATTTGGG - Intronic
1083014068 11:59433647-59433669 ATTGAATATAGGATCTATTTTGG - Intergenic
1084726357 11:70944967-70944989 ATTAGGTACAGTATCTCCTTTGG + Intronic
1085957116 11:81412184-81412206 ATTTGCAACTGTATCTTTTTGGG - Intergenic
1086259205 11:84917183-84917205 ATTTGATATAGTACCTATTACGG - Intronic
1086839036 11:91661642-91661664 ATTTGAAAAAGTATCTTTTAAGG + Intergenic
1087371980 11:97295742-97295764 TTTTTGTACTGTATCTATTTTGG + Intergenic
1089171065 11:116511900-116511922 ATCTGATACAGTGTATGTTTGGG - Intergenic
1090027096 11:123177251-123177273 CTTTGATGCAGTGTGTATTTGGG + Intronic
1090214841 11:124952910-124952932 GTTGGATTCTGTATCTATTTGGG - Intergenic
1091578769 12:1766587-1766609 ATTTGCTAAAGTATATAGTTAGG + Intronic
1093291338 12:17326376-17326398 ATTTCTTACAGTATTTATTGAGG + Intergenic
1095681594 12:44982936-44982958 AAATTATACAGTATCTATTTTGG + Intergenic
1095760450 12:45827980-45828002 ATTTAATATATTATCTTTTTTGG + Intronic
1096048874 12:48588325-48588347 ATTTTTTATAGTATCTATCTGGG - Intergenic
1096373473 12:51087673-51087695 AGTTGATACAGTATATATTTTGG - Intergenic
1098685444 12:73413851-73413873 ATTTAATACAGTATATTTTGGGG + Intergenic
1098777601 12:74640927-74640949 AATTGATACTGTAGCTCTTTTGG - Intergenic
1098834199 12:75401432-75401454 ACTTGATATATTTTCTATTTTGG - Intronic
1099272647 12:80530819-80530841 ATTTGATACAGTAATCATTTTGG + Intronic
1099625859 12:85072777-85072799 TTTTTATACAGTATAGATTTAGG + Intronic
1100095879 12:91035718-91035740 ATTTGATATATTATCTATAGGGG + Intergenic
1100151835 12:91747597-91747619 ATGTAATTCAGTACCTATTTGGG - Intergenic
1100780635 12:98022331-98022353 ATTGGATACTCTATTTATTTAGG - Intergenic
1101299870 12:103468057-103468079 ATATGAAACTTTATCTATTTTGG - Intronic
1103526283 12:121571194-121571216 AATTGATACAGTGTTTCTTTTGG + Intronic
1107658090 13:42612393-42612415 AATTAATACAGTATCTATTCTGG - Intergenic
1108771510 13:53707462-53707484 ATTTTATAATGTATCTTTTTTGG - Intergenic
1109155914 13:58909057-58909079 TTTTAATACAGTAATTATTTGGG - Intergenic
1109235908 13:59819557-59819579 TTCTCATACAGTATGTATTTCGG + Intronic
1109916344 13:68989689-68989711 ATTAGATACAGTCTTTATTTTGG - Intergenic
1110289488 13:73787432-73787454 ATTGGATAAAGTATCTATTGAGG - Intronic
1110314545 13:74090648-74090670 CTTTGATAAAGTATCTCTTGAGG + Intronic
1111181093 13:84665913-84665935 TTTTGATACAGTATATATGTCGG + Intergenic
1111253135 13:85631345-85631367 ATGTGAAACAGTATGTCTTTTGG - Intergenic
1111629806 13:90836086-90836108 ATTTGTTTCATTATCTAATTTGG - Intergenic
1112150161 13:96750596-96750618 ATTTGAAACAGATTTTATTTTGG - Intronic
1114882792 14:26807299-26807321 ATTTTTTAAAGTATTTATTTAGG - Intergenic
1114944804 14:27666867-27666889 TTATGATACAGTTTCTGTTTCGG + Intergenic
1115103845 14:29736302-29736324 ATTGTATATAGTTTCTATTTAGG - Intronic
1116001559 14:39248018-39248040 TTTTGATCCAGTATCTGTTTGGG - Exonic
1119080541 14:71689419-71689441 ATATGATACGGTCACTATTTTGG + Intronic
1119994089 14:79232937-79232959 AACTGCTACAGTATTTATTTTGG - Intronic
1122177094 14:99928750-99928772 ATCTGATAGAGCATCTCTTTTGG + Intronic
1122698444 14:103570276-103570298 ATTTGATGCTGGATCAATTTAGG - Intronic
1124016594 15:25882011-25882033 ATATAATACAGTATCTTTTTTGG - Intergenic
1124221873 15:27856320-27856342 AATTCAAACAGTAACTATTTTGG + Intronic
1124914602 15:33957574-33957596 ATTTGATTTAGTTTCAATTTTGG - Intronic
1125433407 15:39621180-39621202 ATTTCTTACAGTATCTCTTTAGG + Intronic
1126958506 15:53962573-53962595 GTTTGGTACAGCATCTATTAGGG - Intergenic
1126978462 15:54213355-54213377 ATTTTATATAGTTCCTATTTTGG + Intronic
1127380112 15:58423753-58423775 ACTTACTACAGTATGTATTTGGG + Intronic
1127878743 15:63136584-63136606 ATTTGATACAGTATCTATTTGGG + Intronic
1128272389 15:66322229-66322251 ATTTTATACAGGACCTATCTAGG - Intronic
1129583206 15:76833979-76834001 ATTTGATCAAGTGTCAATTTAGG - Intronic
1131457468 15:92593940-92593962 AATAGAAACAGTATTTATTTTGG - Intergenic
1135375424 16:21942979-21943001 ATTGGATACAGTATCTTGGTTGG - Intergenic
1135520502 16:23173368-23173390 TTTTGATCCAATATTTATTTGGG - Intergenic
1137000344 16:35224540-35224562 ATTTAAAAGTGTATCTATTTAGG - Intergenic
1137533678 16:49300597-49300619 ATTTTATTCAATATCTACTTTGG + Intergenic
1138835660 16:60431517-60431539 ATATTATAAAGTACCTATTTGGG + Intergenic
1140565797 16:76040553-76040575 ATTTGGAACAGTATAGATTTGGG + Intergenic
1143311664 17:5996990-5997012 ATATGATAAAGTATCTAGTGGGG - Intronic
1143536821 17:7546049-7546071 AATTGATACAGTATCAATTTAGG - Intergenic
1144117211 17:12108770-12108792 ATTTGAAAGAGTATATATCTTGG - Intronic
1146108490 17:30064676-30064698 ATTTTAGGCTGTATCTATTTGGG - Intronic
1147787264 17:42988114-42988136 CTTTAATACTGTATTTATTTAGG + Intronic
1151269351 17:72981558-72981580 AATTCATCCAGAATCTATTTTGG - Intronic
1152273493 17:79339794-79339816 ATTTGATTCAGAATTTTTTTTGG + Intronic
1152994904 18:397328-397350 ATTTTATTCATTATTTATTTGGG + Intronic
1153064728 18:1033385-1033407 AATTGATACAGTTTCTTTATAGG + Intergenic
1153616014 18:6934143-6934165 ATATGATGAAGTATGTATTTTGG + Intergenic
1154075579 18:11197569-11197591 ATTTGTTTCAGTATCTTTATCGG + Intergenic
1154472507 18:14718666-14718688 ATTTGGTACAGAATTTGTTTGGG - Intergenic
1154946795 18:21169883-21169905 AATGGATACAGTTTCTTTTTGGG + Intergenic
1156922476 18:42539218-42539240 ATTTTATATAGTATTTGTTTTGG - Intergenic
1158008216 18:52697839-52697861 ATATGATTGAGAATCTATTTTGG + Intronic
1162303946 19:9860180-9860202 ATTGGATAAAGTATCCATCTGGG + Intronic
1163138358 19:15330454-15330476 ATTTCATAAAGCATTTATTTCGG - Intronic
1164396686 19:27870992-27871014 TTTTGATAAAGTATCTGTTCAGG - Intergenic
1164681794 19:30139432-30139454 GTTTATTACATTATCTATTTTGG - Intergenic
1165264960 19:34653790-34653812 AGTTCCTTCAGTATCTATTTTGG - Intronic
1167030662 19:46957692-46957714 ATTGGGCACAGTAACTATTTTGG + Intronic
1168244598 19:55105628-55105650 CTTGGATACAGTATCCATTTGGG - Intronic
926468608 2:13223624-13223646 ATTTGAGTCAGTATAAATTTTGG + Intergenic
926938292 2:18108472-18108494 ATTTGAAATAGTATCTTGTTGGG + Intronic
928051804 2:28005731-28005753 ATTTGAAAAACTTTCTATTTTGG + Intronic
928073896 2:28245257-28245279 ATTAGAAACAGAATCTGTTTAGG - Intronic
931328696 2:61256146-61256168 ACTTGAAACAGTATAGATTTTGG - Intronic
931354785 2:61527043-61527065 ATTTGAAACAGTAACATTTTTGG + Intronic
932841527 2:75087680-75087702 ATTTGAAACAGTAAATAATTGGG + Intronic
933253710 2:80057246-80057268 TTTGAATAGAGTATCTATTTGGG - Intronic
933425043 2:82099962-82099984 ATTTCAAACAATATGTATTTAGG + Intergenic
933917941 2:87015394-87015416 ATTTTAAATAGTATTTATTTGGG - Intronic
934005054 2:87754520-87754542 ATTTTAAATAGTATTTATTTGGG + Intronic
935768013 2:106388552-106388574 ATTTTAAATAGTATTTATTTGGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937569876 2:123343643-123343665 AATAGATAGAGTTTCTATTTGGG - Intergenic
937571242 2:123364769-123364791 ATTTGACACAATTTCTGTTTTGG - Intergenic
938098617 2:128480910-128480932 CTTTGATCCATTAGCTATTTTGG - Intergenic
938601738 2:132849464-132849486 ATTTAATACAGTATATTTTTGGG + Intronic
939106730 2:137957098-137957120 ATTTGATAGACTATATTTTTTGG + Intergenic
939221276 2:139304489-139304511 ATTTGATTGAGTATGCATTTGGG - Intergenic
940480469 2:154223329-154223351 GATAGATACTGTATCTATTTGGG + Intronic
940539698 2:154996429-154996451 CTTTGACAAAGTATCTATTCAGG - Intergenic
941395818 2:164971521-164971543 ATCTGAGACAGGTTCTATTTGGG - Intergenic
941570950 2:167169726-167169748 TTTAGAAACAGTATTTATTTGGG + Intronic
941758115 2:169210415-169210437 AGTTGATACAGAATCTTATTAGG - Intronic
941925111 2:170886356-170886378 ATTCGATAGAGTAGATATTTAGG - Intergenic
941949925 2:171144560-171144582 ATTTGACCCATTATTTATTTAGG - Intronic
942842911 2:180385125-180385147 ATTTCATACAGGAACTCTTTGGG - Intergenic
942968283 2:181924388-181924410 ATTTAGTACAGTATGTATTTAGG - Intronic
943098267 2:183455350-183455372 AGGAAATACAGTATCTATTTGGG - Intergenic
943773873 2:191743694-191743716 AATTGATACAGTATCAATTTAGG - Intergenic
944407604 2:199402395-199402417 ATTTGATACATTATCTAGCCAGG + Intronic
945094262 2:206203854-206203876 ATTTGATTTAGTATCTATGCTGG - Intronic
945282554 2:208049602-208049624 ATTCTATAGAGTATATATTTAGG + Intergenic
945559614 2:211322440-211322462 ATTTTATACATTTTCTTTTTGGG - Intergenic
947332470 2:229044555-229044577 ATTTGATACTGAATCTAAGTTGG + Intronic
1169442859 20:5647426-5647448 CTTTAATACAGTCTCTATTCAGG + Intergenic
1170060847 20:12257193-12257215 TATTGATCTAGTATCTATTTTGG - Intergenic
1170304434 20:14922551-14922573 ATTTGATTCATTAACTTTTTTGG + Intronic
1173216657 20:41091522-41091544 ATTTGCTACATTTCCTATTTTGG - Intronic
1173396382 20:42684013-42684035 ATTTGATGCTATATCTACTTAGG - Intronic
1173757396 20:45529319-45529341 ATTTTATACATTATCAATATAGG - Intergenic
1174867759 20:54153667-54153689 ATTATATACAGTATGCATTTAGG + Exonic
1175151125 20:56935310-56935332 CTTTGATCCTGTATCTATTTTGG - Intergenic
1176801983 21:13439227-13439249 ATTTGGTACAGAATTTGTTTGGG + Intergenic
1177049885 21:16220043-16220065 ATTTGATGCAGTATATGTTAAGG + Intergenic
1178202548 21:30424256-30424278 ATTAGATTCAGTTTATATTTTGG + Intronic
1179280690 21:39931418-39931440 ATGGGCTACAGTATTTATTTAGG + Intergenic
949180945 3:1130686-1130708 CCTTGATTCAGAATCTATTTTGG + Intronic
950291502 3:11788185-11788207 AGTTGGTAAAGTATCTACTTTGG + Intergenic
951398167 3:22196972-22196994 AATAGATACACAATCTATTTTGG + Intronic
952775799 3:37044845-37044867 ATTTGCTACAGATTTTATTTAGG + Intronic
955455551 3:59117198-59117220 ATTTTATACAGTAAATATATCGG + Intergenic
957604548 3:82380358-82380380 ATTTTATTCAGCATATATTTGGG + Intergenic
957828995 3:85491087-85491109 ATTTGATGCAGTACCTGATTTGG - Intronic
957899809 3:86474710-86474732 TTTTGGTACAGTAACTCTTTTGG + Intergenic
958428900 3:94013959-94013981 ATTTGATAAAGGTTCTAGTTTGG + Intronic
959956852 3:112249595-112249617 ATTAGATGCAGAATCAATTTTGG + Intronic
960527626 3:118727963-118727985 AATTGATACAGAGTTTATTTAGG + Intergenic
962821967 3:139057652-139057674 ATTTTATAGAATATTTATTTTGG + Intronic
964417335 3:156461147-156461169 AATGGATACAGTCTCTATTTAGG - Intronic
964795702 3:160494685-160494707 TATTGATACAGTTTATATTTTGG - Intergenic
964903045 3:161683177-161683199 AGTTGAAACAAAATCTATTTTGG - Intergenic
965101285 3:164302012-164302034 ATTCCATACAATATCAATTTGGG - Intergenic
965128649 3:164665316-164665338 ATTTCAAATATTATCTATTTGGG + Intergenic
965774826 3:172217680-172217702 ACTTGATAAAGTAGCTAATTGGG + Intronic
965879079 3:173366493-173366515 TTTTCATACAGTATGTATATGGG - Intergenic
967927812 3:194665293-194665315 ATTTGCTAAAATATCTATATAGG + Intronic
969162768 4:5275871-5275893 ATTTTAAACAGAACCTATTTTGG + Intronic
970824923 4:20259486-20259508 TTTTTATGCAGTCTCTATTTTGG + Intronic
970913347 4:21304884-21304906 ATTAAATACTGTATATATTTTGG - Intronic
971649237 4:29250793-29250815 TTTTGATAAAATATCTATTTAGG + Intergenic
972135124 4:35883514-35883536 ATTTTATACAGTATCTATTTTGG + Intergenic
972206379 4:36777998-36778020 ATTTGAGAGAGAATATATTTTGG + Intergenic
972282205 4:37613249-37613271 ATTTTATACAGTTTCTATCATGG - Exonic
972702712 4:41509458-41509480 ATTTGATAGACTTTCTATGTAGG + Intronic
973044838 4:45523190-45523212 ATTTGATTGAGAATATATTTTGG + Intergenic
974242996 4:59275628-59275650 TTTTGAAACTGTATCTGTTTGGG - Intergenic
974665697 4:64958452-64958474 ATTTGATTTGGTTTCTATTTTGG - Intergenic
974689931 4:65285094-65285116 ATTTGATAAAATATTTCTTTGGG - Intergenic
976742965 4:88376123-88376145 ATTTGACACATTATCAAATTGGG - Intergenic
977141602 4:93379925-93379947 AGTTAAAACACTATCTATTTGGG - Intronic
977468559 4:97413313-97413335 AATGGATACAGGATTTATTTTGG - Intronic
978840175 4:113202766-113202788 ACATGATACAGTACCAATTTTGG + Intronic
979942245 4:126776450-126776472 ATATGAGAAAGTATCTGTTTAGG + Intergenic
979992401 4:127390613-127390635 ATTTGATATAGTTTGTAATTTGG - Intergenic
980396266 4:132219989-132220011 AATTGTTACATTATTTATTTTGG + Intergenic
980693876 4:136330634-136330656 ATCTTATACAGTATCTAGTAGGG - Intergenic
981600064 4:146477903-146477925 ACTTGATAGCGTATCTATTTGGG + Intronic
983338321 4:166424241-166424263 ATTAGTTTCAGTACCTATTTTGG + Intergenic
983478960 4:168250202-168250224 ATTTGCCAAAGTATTTATTTAGG + Intronic
984145732 4:176057613-176057635 ATTTCATAAAATATATATTTAGG + Intergenic
987603656 5:20105298-20105320 ATTTAATATAGTATTTATTATGG + Intronic
987653995 5:20782559-20782581 ATTTGTTTCCGTTTCTATTTGGG + Intergenic
988232570 5:28499762-28499784 AAATGATACAATTTCTATTTAGG + Intergenic
988657518 5:33228483-33228505 ATTTGATAAAGTAGATACTTGGG - Intergenic
988741580 5:34078933-34078955 ATTTGTTTCCGTTTCTATTTGGG - Intronic
989087738 5:37693841-37693863 ATTAGATACATTGTCTATTTTGG - Intronic
989560035 5:42840135-42840157 ATTTGTTACATTATCTTTCTGGG + Intronic
990909730 5:60842011-60842033 AGATGATACAGTATAAATTTTGG - Intronic
991458504 5:66831474-66831496 AAATGATGCAGTATGTATTTAGG + Intronic
992379627 5:76224431-76224453 CTTTGATAAAGGATCTAATTAGG - Intronic
993388084 5:87283870-87283892 ACTTAATACAGTGTTTATTTTGG + Intronic
993973270 5:94445530-94445552 ATATGAAACAGTTTATATTTTGG - Intronic
994563656 5:101411785-101411807 ATATGATAAAGCATATATTTTGG + Intergenic
994579182 5:101616975-101616997 AGTTCATACAGAATCTATTTTGG + Intergenic
995888452 5:116922226-116922248 ATTTGTTACAGTAGCTAATTAGG + Intergenic
995901284 5:117070039-117070061 ATTTGTAATAGTATATATTTTGG + Intergenic
996022602 5:118607999-118608021 ATGTGATACAGCATATACTTAGG + Intergenic
996073357 5:119160447-119160469 ATCTAACACAGTATCTATTCTGG + Intronic
996409897 5:123146570-123146592 ATATGAGAAAGTATCAATTTTGG - Intronic
996514013 5:124349882-124349904 ATTTCAAACAGCAACTATTTAGG + Intergenic
996919391 5:128749914-128749936 GTTTGATATTATATCTATTTTGG - Intronic
998124381 5:139606749-139606771 ATTTCATTCAGTAACTATTTTGG + Intronic
998923128 5:147092896-147092918 ATTTGCTAAAGCATCTATTAAGG - Intergenic
998950678 5:147390357-147390379 ATTTGATAAAGAATATACTTTGG + Intergenic
998991703 5:147824206-147824228 ATTTGATTGAGCATCTATTGTGG - Intergenic
999301828 5:150496006-150496028 ATTTGACAAAATATATATTTGGG - Intronic
999593434 5:153174347-153174369 ATTTGGAAAAATATCTATTTAGG + Intergenic
1000166528 5:158654639-158654661 ATTTGACCCACTGTCTATTTGGG - Intergenic
1004784645 6:18953445-18953467 ATTTGATTTTGTTTCTATTTTGG - Intergenic
1005388100 6:25306049-25306071 GTTTGATACAGTTTCTGTTTGGG - Intronic
1007153667 6:39721009-39721031 CTTTGATACAGCATTAATTTAGG - Intronic
1009372093 6:62917784-62917806 AATGGAAACAGTATATATTTGGG + Intergenic
1009433873 6:63595949-63595971 ATTTTTTAAATTATCTATTTTGG + Intergenic
1010146302 6:72673328-72673350 ACTTGATGCATTATATATTTAGG - Intronic
1010702332 6:79065241-79065263 ACTTGATCCAATATGTATTTTGG - Intronic
1011485567 6:87837579-87837601 ATATGATACAATATCTTCTTTGG - Intergenic
1011897938 6:92255472-92255494 ATTTGATAATGTCTCTACTTAGG - Intergenic
1014106014 6:117562219-117562241 TTTTGATACAGTAATTGTTTTGG - Exonic
1014928650 6:127306379-127306401 ATTTGATACGGTTTGGATTTGGG + Intronic
1016681569 6:146834953-146834975 AAATGATACATTATCTATATGGG + Intergenic
1017471594 6:154742539-154742561 ATATGAGACAGAATCCATTTAGG - Intronic
1018128858 6:160708745-160708767 ATTTTAAATAGTATTTATTTGGG + Intronic
1019063067 6:169271076-169271098 ATTTTATACAGTCTTTTTTTGGG - Intergenic
1019753724 7:2751798-2751820 ATTTCATACAGTATCCGTTTTGG - Intronic
1020506791 7:9000697-9000719 ATTTTATGCAGTATCTACTATGG - Intergenic
1020539742 7:9445909-9445931 TTTTAACATAGTATCTATTTTGG + Intergenic
1020951994 7:14691087-14691109 ATTTTAAAGAATATCTATTTTGG - Intronic
1022641461 7:32188861-32188883 ATTTTATTCATCATCTATTTGGG + Intronic
1022778660 7:33555129-33555151 ATTTGAGACAGTGTTTATATTGG - Intronic
1023121026 7:36908790-36908812 ACTTGATACTGTACCTAATTAGG - Intronic
1023186248 7:37536416-37536438 AGAAGATACTGTATCTATTTAGG + Intergenic
1023359627 7:39401820-39401842 ATTTTATAGAGTATGGATTTTGG - Intronic
1024734087 7:52285143-52285165 CTTTCATACAGTATCTCATTAGG + Intergenic
1024874444 7:54005970-54005992 ATTTGATGAAGTAACTATCTAGG + Intergenic
1027403879 7:77837628-77837650 ATTTTAAACTGTATTTATTTGGG - Intronic
1029442822 7:100596672-100596694 AATGGATACAGGAGCTATTTGGG + Intronic
1029919754 7:104250646-104250668 ATTTGCTACAAAATCTCTTTTGG + Intergenic
1031482345 7:122293660-122293682 ATTTGCCAGAGTATCAATTTAGG + Intergenic
1031660372 7:124416854-124416876 ATTTTCTAAATTATCTATTTGGG + Intergenic
1034749637 7:153556709-153556731 ATCTGTTTCAGTATCTGTTTTGG + Intergenic
1035815312 8:2532787-2532809 ATTTTATATATTATGTATTTAGG + Intergenic
1035958311 8:4107890-4107912 ATTTGTTTCAGTTTGTATTTAGG - Intronic
1036115310 8:5952988-5953010 ATTAGATACTGTATGTATTCTGG + Intergenic
1037201800 8:16262775-16262797 ATTTGTTACTATATCAATTTTGG - Intronic
1037420367 8:18695393-18695415 ATTTGATATACTACCTAGTTTGG - Intronic
1040039756 8:42904037-42904059 AATTGCTACAGTATATATTTAGG + Intronic
1041973655 8:63772781-63772803 ATTTGATAAGGGATCTTTTTAGG + Intergenic
1042085525 8:65103945-65103967 AATTGGAACAGAATCTATTTAGG + Intergenic
1043276204 8:78397162-78397184 ATTTGACCCATTATTTATTTAGG + Intergenic
1045663228 8:104459794-104459816 TTTTGTGACAGTGTCTATTTAGG - Intronic
1045752539 8:105502551-105502573 ATTTGCTCTAGTATCTACTTTGG - Intronic
1046040991 8:108904418-108904440 ATTTGATTTGGTTTCTATTTTGG - Intergenic
1046715988 8:117567818-117567840 TTTTGATACTATATCTGTTTAGG + Intergenic
1047319397 8:123765423-123765445 ATTTGATGCATCAGCTATTTGGG + Intergenic
1047336291 8:123939858-123939880 ATTTGATACAGTAACTGTTTAGG - Intronic
1048694447 8:137009486-137009508 TTGTGATTGAGTATCTATTTGGG + Intergenic
1050781036 9:9336379-9336401 TTATGATTCAGTTTCTATTTAGG - Intronic
1051022639 9:12563218-12563240 GTTTGATACCATATATATTTTGG + Intergenic
1052211920 9:25914342-25914364 AATGGACACAGTTTCTATTTAGG + Intergenic
1052371072 9:27665010-27665032 TTTTGATATAGAAGCTATTTAGG + Intergenic
1053310765 9:37017860-37017882 ATTTGACACAGTTTCGAGTTGGG - Intronic
1057255495 9:93543662-93543684 ATATGATACAGTATGTTTATAGG + Intronic
1058357594 9:104102246-104102268 ATTATATATAGTAACTATTTAGG + Intronic
1059529728 9:115024709-115024731 ATGTGATACAGAGACTATTTAGG - Intronic
1061143507 9:128782969-128782991 AATGGTTACAGTTTCTATTTGGG - Intergenic
1187373912 X:18733688-18733710 ATTTGTCACAGTAGCTGTTTGGG + Intronic
1188334497 X:28913724-28913746 ATTAGATACAGCATCTCTTATGG + Intronic
1192257119 X:69470977-69470999 ATCTGACCCAGTATCTGTTTGGG + Intergenic
1193092101 X:77504865-77504887 CTTTGACACAGTATATATTTCGG + Exonic
1193272819 X:79548714-79548736 ATTTGATGCAGTGTCTAGATGGG + Intergenic
1193920438 X:87418585-87418607 ATTTGTTAAAGTCACTATTTTGG - Intergenic
1195356283 X:104042703-104042725 ATTTGATATGGTATTTCTTTGGG + Intergenic
1195811787 X:108841793-108841815 TTTTGAAAAAATATCTATTTAGG + Intergenic
1197292073 X:124670749-124670771 TTTTAATACAGTAGTTATTTGGG - Intronic
1198831500 X:140755717-140755739 ATTTGATAGAGAAACTAATTAGG - Intergenic
1199301245 X:146216530-146216552 ACATGATACAGTATGTGTTTTGG - Intergenic
1201613031 Y:15864522-15864544 ATTTGAAAAAGTGTCTTTTTGGG - Intergenic
1202047338 Y:20748167-20748189 AGTTGATATGGTATCTCTTTGGG - Intergenic