ID: 1127880346

View in Genome Browser
Species Human (GRCh38)
Location 15:63151816-63151838
Sequence AAACCCAGCTTCACAAGGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 2, 2: 24, 3: 50, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127880346_1127880350 22 Left 1127880346 15:63151816-63151838 CCTATCCTTGTGAAGCTGGGTTT 0: 1
1: 2
2: 24
3: 50
4: 227
Right 1127880350 15:63151861-63151883 GCACCATGCAAAAATCAATGTGG 0: 2
1: 0
2: 2
3: 20
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127880346 Original CRISPR AAACCCAGCTTCACAAGGAT AGG (reversed) Exonic
901538091 1:9896277-9896299 AAAGCCAGCATCACCAGAATTGG - Intronic
907379765 1:54076802-54076824 AATGTAAGCTTCACAAGGATAGG - Intronic
907472954 1:54686121-54686143 AATCCCAGCTTCCCCAGGCTGGG + Intronic
908899697 1:68942413-68942435 AAAGCCAGCTTCACAAATGTTGG - Intergenic
909047297 1:70726352-70726374 AAACTAAGCTTCACAAGCAAAGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910578987 1:88800484-88800506 AAACCCACCTTAGCAAAGATGGG + Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912893384 1:113558944-113558966 AAACCAAGCTTCATAAGCAAAGG + Intronic
913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG + Intergenic
914431750 1:147624979-147625001 AATCTCATCTTGACAAGGATCGG - Exonic
915632431 1:157162825-157162847 AGATCCACCTTCACAATGATGGG - Intergenic
915851121 1:159324700-159324722 AAACTCAGCTTCACAAGTGAAGG + Intergenic
916264385 1:162876196-162876218 AAACCCATCTTTAGAAGAATTGG + Intergenic
916824314 1:168429614-168429636 CAACCCAGCGTCACAAGGGAAGG + Intergenic
917079252 1:171239253-171239275 AAACTAAGCTTCACAAGCAAAGG + Intergenic
917616031 1:176745475-176745497 CAAGACAGATTCACAAGGATGGG - Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918301185 1:183205348-183205370 AAAATCAGTTTCACAAGCATTGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920208691 1:204312679-204312701 AATCCCAGTTCCACAAAGATGGG + Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922066413 1:222147667-222147689 AAACTCAGCTTCATAAGCAAAGG + Intergenic
922180673 1:223230610-223230632 CAACCCTGCTTCACACGCATCGG - Intronic
922579087 1:226683768-226683790 AAAGCCAGCTACCCAAGGACAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923726936 1:236514272-236514294 AAACCCACCTTCCCAAGTAAAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068367142 10:56066497-56066519 AAACTAAGCTTCATAAGGAAAGG - Intergenic
1068671051 10:59724053-59724075 AAAGCAAGCTCCATAAGGATAGG + Intronic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1072045085 10:91646056-91646078 AAACTAAGCTTCACAAGCAAAGG + Intergenic
1072814302 10:98489571-98489593 ACCCCCAGCTTGACAAGCATTGG + Intronic
1072831800 10:98665681-98665703 AAACTCAGCTTCATAAGCAAAGG + Intronic
1074425048 10:113343280-113343302 AGACCCAACTTCACAGGGAAAGG - Intergenic
1074427277 10:113362633-113362655 AAACCCACCTTCGCAGGGACTGG + Intergenic
1076031051 10:127158935-127158957 AAACCCAGTTCTAGAAGGATGGG - Intronic
1076222003 10:128741371-128741393 ACACCCAACTTCCCAAGCATGGG + Intergenic
1077855271 11:6117488-6117510 AAACTAAGCTTCACAAGCAAAGG + Intergenic
1078022205 11:7665402-7665424 TAACCCAGCTTCTCCAGGTTAGG + Exonic
1078821800 11:14890855-14890877 AAACCAATTTTTACAAGGATTGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079362807 11:19783440-19783462 AATCTGAGCTTCAAAAGGATGGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1080825253 11:35843078-35843100 AAACTCAGCTTCCTCAGGATAGG + Intergenic
1080897546 11:36459065-36459087 AAACACAGCTTCAAAGGGCTGGG - Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1086760255 11:90621108-90621130 AAACTAAGCTTCACAAGCAGAGG + Intergenic
1087608982 11:100410804-100410826 AAACCAAGCTTCACAAGTGAAGG + Intergenic
1087626913 11:100605658-100605680 AAACTAAGCTTCATAAGCATAGG + Intergenic
1087642083 11:100765812-100765834 AAATCCAGCTTCTCTAGGATTGG - Intronic
1087767317 11:102169765-102169787 AAACCAAGCTTCTTAAGGATTGG - Intronic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1092297077 12:7209225-7209247 AAACCCAGCTTCCCAACAAATGG - Intronic
1093651057 12:21646117-21646139 AACACCAGATTCACCAGGATGGG + Intronic
1094257637 12:28451868-28451890 AAACCCAGTCTCACACAGATAGG - Intronic
1094638127 12:32246885-32246907 CAACCCAGCTTCTCAATGAGAGG - Intronic
1094681371 12:32670256-32670278 AGACCAAGGTTCCCAAGGATTGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1095059390 12:37664836-37664858 AAACTCAGCTTCACAAGTGAAGG - Intergenic
1095060600 12:37683495-37683517 AAACTCAGCTTCACAAGTGAAGG + Intergenic
1095365754 12:41403117-41403139 AAACCCAGCTTCATAGCAATAGG + Intronic
1096965684 12:55625541-55625563 AAGCCCAGAGTCACAAGGACAGG + Intergenic
1098331554 12:69358995-69359017 AGACACTGCTTCAGAAGGATGGG - Intergenic
1098788410 12:74788493-74788515 AAACCAAGCTTCATAAGCAAAGG + Intergenic
1100956967 12:99919522-99919544 AAACACAGATTCACAAGAAGAGG + Intronic
1104619791 12:130302324-130302346 AAGGCCAGTTTCACAGGGATTGG - Intergenic
1112345047 13:98582196-98582218 AAATCCAGCTTCAAGAGGAAGGG - Intergenic
1112712516 13:102146486-102146508 AAAGGCAGCTTCAAAAGTATTGG - Intronic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1112963640 13:105159848-105159870 AAAACAACCTTCACAAGCATAGG + Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114395081 14:22350793-22350815 AAACCAAGCTTCACAAGTGAAGG + Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116565600 14:46440371-46440393 AAACCAAGCTTCATAAGCAAAGG + Intergenic
1117104477 14:52384046-52384068 AAACTAAGCTTCACAAGCAAAGG + Intergenic
1117702144 14:58424895-58424917 AAACCTAGCATCACAAACATGGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1122931604 14:104935425-104935447 AAATCCAGCTTGACAAGGCTTGG + Exonic
1123771286 15:23531895-23531917 AAAGTCAGCTTAACTAGGATAGG - Intergenic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1129194930 15:73958203-73958225 AACCGCAGCTTGAAAAGGATTGG + Intergenic
1130172110 15:81525518-81525540 CAACCCATCATCACAATGATTGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132658997 16:1053332-1053354 CAACCCAGCCTGCCAAGGATGGG - Intergenic
1136811983 16:33184394-33184416 AAACACAGCACCACAAGGAGGGG - Intergenic
1136818459 16:33294474-33294496 AAACACAGCACCACAAGGAGGGG - Intronic
1136825023 16:33351007-33351029 AAACACAGCACCACAAGGAGGGG - Intergenic
1136830089 16:33449778-33449800 AAACACAGCACCACAAGGAGGGG - Intergenic
1137729382 16:50678818-50678840 GAACCCACGTTCACAAGGCTGGG + Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139642494 16:68302688-68302710 GAGCCCAGCTCCACAATGATAGG + Intronic
1139757770 16:69158789-69158811 TAACCCAGCTGCCAAAGGATGGG - Intronic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1202990561 16_KI270728v1_random:7364-7386 AAACACAGCACCACAAGGAGGGG - Intergenic
1143297902 17:5884957-5884979 AAACTCAGCCGCACAAGAATAGG - Intronic
1143734540 17:8901208-8901230 CAACCCAGCTTCCCAAGGAAAGG - Intronic
1144616700 17:16782577-16782599 AAACCAAGCTTCATAAGCAAAGG - Intronic
1144895992 17:18533084-18533106 AAACCAAGCTTCATAAGCAAAGG + Intergenic
1145005743 17:19336793-19336815 AGACCAAGCTCCACAAGAATCGG - Intergenic
1145136221 17:20411136-20411158 AAACCAAGCTTCATAAGCAAAGG - Intergenic
1146683283 17:34823938-34823960 AGACCCAGTTACACAGGGATGGG - Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150797408 17:68249088-68249110 AAAGCCAGCCTCACAATGACAGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1154354318 18:13613354-13613376 AAACACAGCTGCACATGGAATGG - Intronic
1156890782 18:42187233-42187255 GAACCCACCTGCACAAGGAGGGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160515992 18:79479590-79479612 AAACTCACCTTCACAAGCAAAGG - Intronic
1164483454 19:28633684-28633706 AAAGCCATCTCCACAAGGCTTGG + Intergenic
1165798840 19:38535408-38535430 AAACACAGCTTAACAAGAAGAGG - Intronic
1168486734 19:56768830-56768852 AAAGCCAGCATCTCAAGAATAGG - Intergenic
926288033 2:11506249-11506271 AAACCACGCTTCTCAAGGACAGG - Intergenic
926648749 2:15318143-15318165 AAACCAAGCTTCATAAGGGAAGG + Intronic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927731571 2:25477821-25477843 AAACGCAGATTCAGAATGATTGG - Intronic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
930897853 2:56466044-56466066 AAACTAAGCTTCATAAGCATAGG + Intergenic
933301624 2:80547215-80547237 AAATCCAGCTTTTCAATGATGGG + Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
939541322 2:143497535-143497557 AAAGCCAGCTTCACGAGCAGTGG + Intronic
940730017 2:157377636-157377658 AAACCCAATTTCATAAAGATAGG - Intergenic
940807108 2:158200085-158200107 AAAATCAGCTGCACAAGGACAGG + Intronic
943141671 2:183991166-183991188 AAACTAAGCTTCACAAGCAAAGG - Intergenic
943237128 2:185337247-185337269 AAACACAGCTTTACAGGGATGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
943935545 2:193910689-193910711 ACACCCAGCTTTAAAAGGACAGG + Intergenic
945216944 2:207444041-207444063 AACCCCAGATCCACAAGGAGGGG + Intergenic
945305172 2:208253470-208253492 AATCCCAACTTCAGAAGGAAGGG + Intronic
947349646 2:229229789-229229811 AAACCCAGCTCCACCAGGAAAGG - Intronic
948831313 2:240599504-240599526 AACCCCAGGTTCACATGGACTGG + Intronic
1169158189 20:3352290-3352312 AAACCCAGACCCAAAAGGATTGG - Intronic
1170712584 20:18805732-18805754 ACAGCCACCTTCACAAGGGTGGG + Intergenic
1171344729 20:24457426-24457448 AACCCCAGCCTGACAAGGAAGGG + Intergenic
1173595583 20:44257004-44257026 AAACCCAGGTGCCCAAGAATGGG + Intronic
1174927910 20:54781123-54781145 AATCCCAGCTTCAAAATGGTTGG - Intergenic
1175086154 20:56460915-56460937 GAACCAAGCCTCACAAAGATGGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180115582 21:45702029-45702051 AAACCCAGCCTCACATGAATAGG + Intronic
1180258276 21:46649175-46649197 AAACCCAGGTTCTCAGGGAAGGG - Intronic
1183544921 22:38450341-38450363 CAGCCCAGGTTCACATGGATGGG + Intronic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1184807430 22:46804118-46804140 AAACCCAGAGTCACACGGTTGGG - Intronic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
949601386 3:5601852-5601874 AAACTCAGCTTCATAAGCAGAGG + Intergenic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
952572519 3:34733715-34733737 AAACTAAGCTTCATAAGGAAAGG + Intergenic
952659033 3:35822905-35822927 AAACTAAGCTTCACAAGCAAAGG - Intergenic
953070997 3:39519524-39519546 AAACCCACATTAACAAGAATTGG - Intronic
954724332 3:52594816-52594838 AAACCAAGCTTCATAAGCAAAGG - Intronic
955486113 3:59436439-59436461 AAACCCAGCATCAAAAGTTTAGG + Intergenic
955575420 3:60357360-60357382 AATCCCAGCTACTCAAGAATGGG - Intronic
957696636 3:83648392-83648414 AAACTAAGCTTCATAAGGAGAGG - Intergenic
958694375 3:97509432-97509454 AAACTAAGCTTCACAAGCAAAGG - Intronic
960257924 3:115531588-115531610 AAACTAAGCTTCACAAGCAAAGG - Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
962078933 3:132116479-132116501 AAACTAAGCTTCACAAGCAAAGG - Intronic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
962932428 3:140050686-140050708 AAACCCAGCCAGACAAGGAGAGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963401548 3:144805236-144805258 AAACTAAGCTTCACAAGCAAAGG - Intergenic
964851324 3:161099414-161099436 AAAACCAGCTGCACAAGGGCAGG + Intronic
965221576 3:165933001-165933023 AAACTAAGCTTCACAAGGGAAGG + Intergenic
965263524 3:166512378-166512400 AAACTCAGCTTCACAAGCAAAGG + Intergenic
967493806 3:190121150-190121172 AAATCCAGCTTAGCAAGGTTAGG + Intronic
968005406 3:195239249-195239271 AAACTAACCTTCCCAAGGATGGG + Intronic
969077574 4:4592449-4592471 AAACCAGGCTTCAGAAGGACAGG + Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
973011479 4:45080633-45080655 AAACTAAGCTTCATAAGGAAAGG - Intergenic
973825397 4:54700225-54700247 AAACCCATCTTCAAATGGATAGG - Intronic
973873586 4:55191385-55191407 AAACCAAGCTTCACAAGCAAAGG + Intergenic
974814148 4:66983629-66983651 AAACTAAGCTTCACAAGGGAAGG + Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977627105 4:99199524-99199546 AAACTAAGCTTCATAAGTATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978642836 4:110891762-110891784 TAGCCCTGCTCCACAAGGATTGG + Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
981338366 4:143592487-143592509 AAACTAAGCTTCACAAGCAAAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982725374 4:158901079-158901101 AAACTAAGCTTCACAAGCAAAGG - Intronic
983244248 4:165269560-165269582 AAACTCAGCTTCATAAGTAAAGG - Intronic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
985224043 4:187739939-187739961 AAACCAAGCTTTACAAGCAAAGG + Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988827968 5:34959018-34959040 AAAATCAGCCTCACATGGATAGG + Intergenic
990501857 5:56404370-56404392 AAAGCCATCTTCACAAGGACTGG - Intergenic
995127850 5:108597650-108597672 AAACACAGATGCACAAGGTTGGG + Intergenic
995188165 5:109292459-109292481 AAACTAAGCTTCACAAGCAAAGG + Intergenic
995308657 5:110686164-110686186 AAGCCCAGATTCACAAGTATTGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996758258 5:126958801-126958823 AAACCTAACTCCACAATGATGGG + Intronic
996760093 5:126978198-126978220 AAATCCAGCTGCAAAAGTATTGG - Intronic
997188305 5:131903546-131903568 AAACCAAGCTTCATAAGCAAAGG + Intronic
997418644 5:133748988-133749010 ATACCCACCCTCTCAAGGATAGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1001225947 5:169944639-169944661 AATCCCCACTTCACAATGATTGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003302671 6:4898489-4898511 AAACCCACTTACACAAGGAAAGG + Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1010671929 6:78696196-78696218 AAACCAAGCTTCATAAGTAAAGG + Intergenic
1011239138 6:85252353-85252375 AAACCCACCTCCCCAAAGATGGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013972979 6:116042480-116042502 AAACTAAGCTTCACAAGCAAAGG + Intronic
1014354421 6:120387079-120387101 AAAGACAGCATCACAATGATTGG - Intergenic
1014630615 6:123785200-123785222 AAACCCAGATGCAGAAAGATGGG - Intergenic
1016338343 6:143033615-143033637 AAACTAAGCTTCACAAGGGAAGG - Intergenic
1016417749 6:143850936-143850958 AAACCCAGCATCACAGGGTTGGG + Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017963252 6:159240539-159240561 AAGCCCAGCTACATGAGGATTGG - Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG + Intergenic
1019045223 6:169140246-169140268 AAACCCAGTTTCTCAGGAATGGG + Intergenic
1019060282 6:169252484-169252506 ATGCCCAGCTTCATAAGGACAGG + Intronic
1019782762 7:2953866-2953888 AGACCCAACTTCACAAGGCTTGG - Intronic
1020690737 7:11351863-11351885 AAACTAAGCTTCACAAGCAAAGG - Intergenic
1021749153 7:23778082-23778104 AAACTAAGCTTCACAAGCAAAGG - Intronic
1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG + Intergenic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1024453323 7:49574806-49574828 AAACCCAGGTTAAGAAGCATTGG + Intergenic
1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG + Intergenic
1027959415 7:84925504-84925526 GCACTCAGATTCACAAGGATGGG + Intergenic
1028185715 7:87783746-87783768 AAACCAAGCTTCATAAGAAAAGG - Intronic
1030158997 7:106488400-106488422 AAACCTAGCTTCACTGGGTTTGG + Intergenic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1032223149 7:130009286-130009308 AAGCCCAGCTTTAGAAGCATTGG - Intergenic
1032464482 7:132135345-132135367 AAACCCAGGTTCCCATGGAAAGG + Intronic
1032553358 7:132806142-132806164 TAACACAGCATCACAAGGCTGGG + Intronic
1033510257 7:142053625-142053647 AAACTAAGCTTCTCAAGGACAGG + Intronic
1033513059 7:142079650-142079672 AAACTAATCTTCTCAAGGATAGG + Intronic
1033541637 7:142361672-142361694 AAACTAAGCTTCATAAGGAAAGG - Intergenic
1033620940 7:143061606-143061628 AAACCCAGCCTCAGAAGGCCTGG + Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1037470517 8:19204435-19204457 AAACCAAGCTTCATAAGCAAAGG + Intergenic
1040507921 8:48068205-48068227 AAAGCCAGGTTCACAAAGCTTGG + Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043637326 8:82402396-82402418 AAACGCAGCTGCTCAATGATGGG + Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044855856 8:96475113-96475135 ACACCGAGTTTCAGAAGGATGGG + Intergenic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1048605863 8:135968336-135968358 AAACCCAGCTCCCCAAGGAAAGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050451041 9:5781358-5781380 AAACCAAGCTTCATAAGCAAAGG + Intronic
1051269748 9:15343959-15343981 CACCCCAGCTTCCCAAGAATGGG + Intergenic
1051484444 9:17592984-17593006 AAACCCAACATCACAGGGTTTGG + Intronic
1052391274 9:27881336-27881358 AAAGCCAGCTACAAAAGGAAAGG - Intergenic
1053831364 9:42085159-42085181 AAATACAGCTTCACATGAATTGG + Intronic
1054599183 9:67102279-67102301 AAATACAGCTTCACATGAATTGG - Intergenic
1056369382 9:85939306-85939328 AAACCGAACTTCACAAAAATTGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1058893149 9:109378575-109378597 AAACCCAGCTTCTGGAGGGTTGG - Exonic
1059237988 9:112778607-112778629 CTACCCAGATTCACCAGGATGGG + Intronic
1059623576 9:116036073-116036095 AAACCCAGCTGCACAAGCCAAGG - Intergenic
1185846021 X:3439151-3439173 AAACTAAGCTTCACAAGGGAAGG - Intergenic
1186214787 X:7288708-7288730 AGACCCAAATTCACAAGAATAGG - Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1189754336 X:44255018-44255040 AAACTAAGCTTCACAAGCAAGGG + Intronic
1190966531 X:55306250-55306272 AAACTAAGCTTCATAAGGAAAGG - Intergenic
1191097245 X:56686868-56686890 AAACTAAGCTTCAGAAGCATAGG - Intergenic
1192505711 X:71680865-71680887 AAACTTAGCTGCAGAAGGATAGG - Intergenic
1192764934 X:74130449-74130471 CAAACTACCTTCACAAGGATGGG + Intergenic
1193094314 X:77529553-77529575 AAACCAAGCTTCATAAGCAAAGG + Intronic
1194210957 X:91067993-91068015 AAACCAAGCTTCATAAGCAAAGG + Intergenic
1194589726 X:95784995-95785017 ACACCCAGCTTTCCAAAGATTGG - Intergenic
1195102514 X:101568731-101568753 AAACTAAGCTTCATAAGGAAAGG + Intergenic
1195616269 X:106914459-106914481 AAATCCAGCCCCACAAAGATAGG - Intronic
1195938566 X:110147749-110147771 CACCCCAGCTTCTCAAGGTTTGG + Intronic
1199006886 X:142710143-142710165 ACACACAGTTTCACATGGATGGG - Intergenic
1199137248 X:144267313-144267335 AAACTGAGCTTCACAAGCAAAGG + Intergenic
1199367042 X:146999573-146999595 AAACCCATCTTCACCAGAAAAGG + Intergenic